Incidental Mutation 'R1558:Olfr924'
ID170424
Institutional Source Beutler Lab
Gene Symbol Olfr924
Ensembl Gene ENSMUSG00000062103
Gene Nameolfactory receptor 924
SynonymsMOR171-27P, GA_x6K02T2PVTD-32543982-32544908, Olfr1520-ps1, MOR171-27P, MOR171-47
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38844449-38851495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38848904 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 263 (N263K)
Ref Sequence ENSEMBL: ENSMUSP00000149849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072977] [ENSMUST00000217350]
Predicted Effect probably benign
Transcript: ENSMUST00000072977
AA Change: N263K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072744
Gene: ENSMUSG00000062103
AA Change: N263K

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 4.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 279 7.2e-7 PFAM
Pfam:7tm_1 38 287 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
AA Change: N263K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Olfr924
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr924 APN 9 38848252 missense probably damaging 1.00
IGL01673:Olfr924 APN 9 38849020 missense probably benign 0.00
IGL01769:Olfr924 APN 9 38848333 missense probably benign 0.01
IGL02015:Olfr924 APN 9 38848794 missense probably damaging 0.99
IGL02525:Olfr924 APN 9 38848240 missense possibly damaging 0.82
IGL02728:Olfr924 APN 9 38848926 missense probably damaging 1.00
IGL02944:Olfr924 APN 9 38848752 missense possibly damaging 0.88
IGL03127:Olfr924 APN 9 38848209 missense probably damaging 1.00
R0613:Olfr924 UTSW 9 38848613 nonsense probably null
R0811:Olfr924 UTSW 9 38848509 missense probably benign
R0812:Olfr924 UTSW 9 38848509 missense probably benign
R1604:Olfr924 UTSW 9 38848704 missense probably benign 0.04
R1681:Olfr924 UTSW 9 38848513 missense probably damaging 1.00
R1730:Olfr924 UTSW 9 38848972 missense probably damaging 1.00
R1783:Olfr924 UTSW 9 38848972 missense probably damaging 1.00
R1791:Olfr924 UTSW 9 38848605 missense possibly damaging 0.75
R2144:Olfr924 UTSW 9 38848339 missense probably damaging 1.00
R5741:Olfr924 UTSW 9 38848603 nonsense probably null
R6521:Olfr924 UTSW 9 38848597 missense probably benign
R6808:Olfr924 UTSW 9 38848789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTATGTTGCCATCTGTAGCC -3'
(R):5'- ACTCAATTTGTCAGGATAGCTGCCTTC -3'

Sequencing Primer
(F):5'- TGGGGCTACTGTCCATACAAC -3'
(R):5'- GATAGCTGCCTTCCACCAAC -3'
Posted On2014-04-13