Incidental Mutation 'R1558:Cdkl3'
ID170433
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Namecyclin-dependent kinase-like 3
SynonymsB230379H01Rik
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location52004221-52089784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52032510 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 538 (M538K)
Ref Sequence ENSEMBL: ENSMUSP00000123279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000109081] [ENSMUST00000120374] [ENSMUST00000121591] [ENSMUST00000128853] [ENSMUST00000143228] [ENSMUST00000150736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063303
AA Change: M538K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000063321
AA Change: M538K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109076
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109077
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109078
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000109079
AA Change: M538K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109080
AA Change: M538K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000109081
AA Change: M538K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120374
AA Change: M538K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000121591
AA Change: M538K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000128853
AA Change: M171K

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121945
Gene: ENSMUSG00000020389
AA Change: M171K

DomainStartEndE-ValueType
Blast:S_TKc 1 110 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136021
Predicted Effect possibly damaging
Transcript: ENSMUST00000143228
AA Change: M538K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389
AA Change: M538K

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000147874
AA Change: M96K
SMART Domains Protein: ENSMUSP00000119505
Gene: ENSMUSG00000020389
AA Change: M96K

DomainStartEndE-ValueType
Blast:S_TKc 2 36 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150736
AA Change: M50K

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect unknown
Transcript: ENSMUST00000154701
AA Change: M21K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Predicted Effect probably benign
Transcript: ENSMUST00000207272
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alox12b T C 11: 69,165,885 F369S probably damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 52029856 missense probably benign 0.28
IGL01632:Cdkl3 APN 11 52005072 missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 52025917 missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 52011237 missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 52005069 missense probably benign 0.43
IGL02510:Cdkl3 APN 11 52011270 missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0480:Cdkl3 UTSW 11 52005055 missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 52032416 missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 52011308 missense probably damaging 1.00
R0848:Cdkl3 UTSW 11 52011267 missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 52033514 missense possibly damaging 0.90
R2046:Cdkl3 UTSW 11 52026850 missense probably benign
R2077:Cdkl3 UTSW 11 52026839 missense probably damaging 0.98
R2207:Cdkl3 UTSW 11 52027193 makesense probably null
R2271:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R2272:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R4032:Cdkl3 UTSW 11 52011291 missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 52005034 missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 52011168 missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 52022744 missense probably damaging 1.00
R6559:Cdkl3 UTSW 11 52025869 missense probably benign 0.04
R7034:Cdkl3 UTSW 11 52027215 missense probably benign 0.00
R7068:Cdkl3 UTSW 11 52011327 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGGAAAATGTCCCTGGGAGTC -3'
(R):5'- GCGCTTTCCCCACATTATGTATGGAAC -3'

Sequencing Primer
(F):5'- GATTTGTGTGTCACCCACAGTTC -3'
(R):5'- gaaggaggaagcaggcag -3'
Posted On2014-04-13