Incidental Mutation 'R1558:Alox12b'
ID170435
Institutional Source Beutler Lab
Gene Symbol Alox12b
Ensembl Gene ENSMUSG00000032807
Gene Namearachidonate 12-lipoxygenase, 12R type
Synonymse-LOX2, 12R-LOX, Aloxe2
MMRRC Submission 039597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1558 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69156989-69169792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69165885 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 369 (F369S)
Ref Sequence ENSEMBL: ENSMUSP00000035250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036424]
Predicted Effect probably damaging
Transcript: ENSMUST00000036424
AA Change: F369S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035250
Gene: ENSMUSG00000032807
AA Change: F369S

DomainStartEndE-ValueType
LH2 2 116 9.9e-32 SMART
low complexity region 164 175 N/A INTRINSIC
Pfam:Lipoxygenase 228 686 5.3e-59 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the conversion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene can prevent the formation of the epidermal permeability barrier and cause an ichthyosiform phenotype. [provided by RefSeq, Sep 2015]
PHENOTYPE: Neonatal homozygous mutant mice exhibit reddened skin that quickly dehydrates and appears scaly. The epidermis is hyperkeratotic, and its permeability barrier function is compromised. Homozygotes die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,065,705 I708F probably benign Het
4933406M09Rik G A 1: 134,390,774 G428D probably damaging Het
Abca1 T A 4: 53,092,887 Q299L probably null Het
Adamts9 T G 6: 92,908,711 K399N possibly damaging Het
Alpk2 A G 18: 65,350,230 Y236H probably benign Het
Ankrd36 T C 11: 5,635,329 L380P probably damaging Het
Atp2a1 C T 7: 126,452,672 A468T possibly damaging Het
Caprin1 A T 2: 103,775,987 F303I possibly damaging Het
Casp7 A T 19: 56,433,252 R41* probably null Het
Ccdc66 T A 14: 27,486,506 H753L probably benign Het
Ccnc T C 4: 21,742,671 M166T probably benign Het
Cdkl3 T A 11: 52,032,510 M538K possibly damaging Het
Cercam G A 2: 29,876,239 A345T probably benign Het
Chmp3 T A 6: 71,560,970 C60* probably null Het
Ddx1 C T 12: 13,239,541 G125S probably damaging Het
Defb7 A G 8: 19,497,551 D24G probably benign Het
Dgcr8 A T 16: 18,259,588 Y653N probably damaging Het
Dsc2 T C 18: 20,050,151 D70G probably damaging Het
Erich3 T G 3: 154,714,068 N266K probably damaging Het
Fastk A T 5: 24,444,047 probably null Het
Fat4 A G 3: 38,888,986 N676S probably damaging Het
Fermt1 A T 2: 132,934,819 probably null Het
Fmn1 A G 2: 113,693,118 T1149A possibly damaging Het
Foxo3 A G 10: 42,197,072 V483A probably damaging Het
Fpgs T C 2: 32,685,840 T364A possibly damaging Het
Gm12185 A G 11: 48,915,435 S310P probably damaging Het
Gm15056 A T 8: 20,901,933 probably benign Het
Hcn1 T C 13: 117,975,576 V692A unknown Het
Izumo3 A C 4: 92,146,903 C26G probably damaging Het
Kcnf1 T C 12: 17,175,473 Y249C probably damaging Het
Kcnj6 T C 16: 94,762,499 E380G possibly damaging Het
Kdm3b A G 18: 34,809,096 T747A probably damaging Het
Lrba G A 3: 86,351,315 G1370R probably damaging Het
Mei1 G A 15: 82,107,133 R504Q probably damaging Het
Mipol1 T C 12: 57,332,341 I195T probably damaging Het
Mum1 G T 10: 80,232,944 R307S probably benign Het
Ncor2 G A 5: 125,033,546 T1350I probably damaging Het
Npy A G 6: 49,823,725 E43G probably damaging Het
Olfr1152 T A 2: 87,868,115 N41K probably damaging Het
Olfr1507 T A 14: 52,490,146 I273F probably benign Het
Olfr924 T A 9: 38,848,904 N263K probably benign Het
Pcdhb3 T C 18: 37,301,581 L200P probably damaging Het
Pcnt G A 10: 76,422,922 H570Y possibly damaging Het
Pkd1l2 A C 8: 117,082,252 D66E possibly damaging Het
Plekhg4 A G 8: 105,381,835 D1170G possibly damaging Het
Poln T A 5: 34,032,799 H672L probably benign Het
Pqlc2 A T 4: 139,300,080 probably benign Het
Ptprq T C 10: 107,644,043 Y1122C probably damaging Het
Ptrhd1 A G 12: 4,236,505 Y132C probably damaging Het
Riok1 G T 13: 38,050,855 R300L probably damaging Het
Sbf2 G T 7: 110,428,346 T481K probably damaging Het
Sidt2 A T 9: 45,951,800 M11K probably damaging Het
Syne1 G A 10: 5,349,280 R992* probably null Het
Tmem2 T A 19: 21,797,982 Y196* probably null Het
Tmem8b C A 4: 43,681,134 R384S possibly damaging Het
Trim28 T C 7: 13,027,834 Y243H probably damaging Het
Trpm6 T C 19: 18,786,828 M266T probably benign Het
Tsg101 A T 7: 46,889,689 S368T probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttc6 G A 12: 57,686,346 V1092I probably benign Het
Vps13b C T 15: 35,534,319 T927I probably damaging Het
Zfr C T 15: 12,140,644 T259I unknown Het
Other mutations in Alox12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Alox12b APN 11 69166243 missense probably damaging 1.00
IGL02990:Alox12b APN 11 69163206 missense probably benign 0.17
IGL03106:Alox12b APN 11 69168876 nonsense probably null
R0126:Alox12b UTSW 11 69167471 missense probably benign 0.36
R0135:Alox12b UTSW 11 69162748 missense probably benign 0.06
R0305:Alox12b UTSW 11 69167379 missense probably benign 0.25
R0432:Alox12b UTSW 11 69169556 missense probably damaging 1.00
R0828:Alox12b UTSW 11 69166306 missense possibly damaging 0.89
R0854:Alox12b UTSW 11 69164476 critical splice donor site probably null
R1139:Alox12b UTSW 11 69164405 missense probably damaging 1.00
R1870:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R4088:Alox12b UTSW 11 69158385 missense probably benign 0.14
R4195:Alox12b UTSW 11 69169600 missense probably benign 0.02
R4248:Alox12b UTSW 11 69163605 missense probably benign
R4371:Alox12b UTSW 11 69169616 missense possibly damaging 0.86
R4774:Alox12b UTSW 11 69163207 missense probably benign 0.00
R5108:Alox12b UTSW 11 69157382 missense probably benign 0.11
R5252:Alox12b UTSW 11 69165936 missense probably damaging 1.00
R5579:Alox12b UTSW 11 69162932 missense probably benign 0.04
R6000:Alox12b UTSW 11 69169568 missense probably damaging 0.98
R6168:Alox12b UTSW 11 69169634 missense probably damaging 1.00
R6322:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R6634:Alox12b UTSW 11 69168821 nonsense probably null
R7026:Alox12b UTSW 11 69157305 missense possibly damaging 0.66
X0018:Alox12b UTSW 11 69157299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGGAATATGCTTAGGGCACAG -3'
(R):5'- GCCACAGAGCAGAAGTTTTCAAGACC -3'

Sequencing Primer
(F):5'- CTTAGGGCACAGGGTATAAGAGC -3'
(R):5'- GCAGAAGTTTTCAAGACCTTCTTCC -3'
Posted On2014-04-13