Incidental Mutation 'R1559:Slco6c1'
ID170464
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Namesolute carrier organic anion transporter family, member 6c1
Synonyms4933404A18Rik
MMRRC Submission 039598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1559 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location97059038-97128301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97098498 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 334 (D334V)
Ref Sequence ENSEMBL: ENSMUSP00000140791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
Predicted Effect probably damaging
Transcript: ENSMUST00000027569
AA Change: D351V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: D351V

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189547
AA Change: D334V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: D334V

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,399,180 W3585R probably null Het
Babam1 G C 8: 71,397,780 E18Q probably damaging Het
Bcan G T 3: 87,994,212 S394R probably damaging Het
Birc6 T A 17: 74,692,237 F4653L probably damaging Het
Camsap2 A T 1: 136,282,094 H559Q probably benign Het
Cars2 G T 8: 11,530,430 probably null Het
Ccdc93 T A 1: 121,461,983 probably benign Het
Ccna2 C A 3: 36,570,730 probably benign Het
Cdc6 T A 11: 98,912,211 L326I probably damaging Het
Cdh23 A T 10: 60,419,699 probably benign Het
Cenpe T A 3: 135,270,900 S2423T probably benign Het
Cftr A G 6: 18,225,937 M295V probably benign Het
Cxcl2 A G 5: 90,904,012 H23R probably benign Het
Cyp4a12b A G 4: 115,433,984 T370A probably damaging Het
Daam2 A G 17: 49,496,120 probably benign Het
Dclk3 T C 9: 111,469,208 F607L probably damaging Het
Des T G 1: 75,360,586 S57A probably benign Het
Drd1 A T 13: 54,052,945 S410T probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fanci T C 7: 79,433,193 L639P probably damaging Het
Fancm A G 12: 65,093,689 E395G probably benign Het
Gm996 G T 2: 25,577,031 S956* probably null Het
Grik3 A G 4: 125,707,997 D889G probably benign Het
Heyl A G 4: 123,241,399 S62G probably damaging Het
Hmox1 C T 8: 75,099,949 P267L probably damaging Het
Ifi213 A C 1: 173,567,218 S584A probably benign Het
Il12rb2 G T 6: 67,356,592 F234L probably benign Het
Il4i1 T A 7: 44,839,387 S233T probably damaging Het
Itga4 A G 2: 79,315,688 S745G probably benign Het
Kalrn T A 16: 34,010,548 I734F possibly damaging Het
Klk1b16 T C 7: 44,141,001 I200T probably benign Het
Lrrc4c T A 2: 97,630,772 M581K probably benign Het
M6pr A T 6: 122,315,074 I122L probably benign Het
Magi3 T C 3: 104,046,853 probably benign Het
Mybpc2 T G 7: 44,513,687 T480P probably benign Het
Olfr301 T C 7: 86,412,367 S43P probably benign Het
Olfr346 A G 2: 36,688,758 Y252C probably damaging Het
Olfr613 A T 7: 103,552,165 I127F possibly damaging Het
Olfr937 T C 9: 39,060,141 N175S probably benign Het
Pcx T A 19: 4,619,086 I704N probably damaging Het
Pde3a G T 6: 141,459,098 A350S probably damaging Het
Ppox A T 1: 171,280,006 probably benign Het
Ppp1r32 T C 19: 10,481,406 T87A probably benign Het
Prb1 T A 6: 132,208,544 Y42F unknown Het
Rsph4a T A 10: 33,909,731 V546E probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sh3tc1 A G 5: 35,703,349 probably null Het
Slc22a2 T C 17: 12,584,411 F44S probably damaging Het
Smim19 T C 8: 22,463,336 D105G probably damaging Het
Smpdl3a A G 10: 57,807,492 T233A probably damaging Het
St8sia5 G A 18: 77,211,764 probably null Het
Stk32a C A 18: 43,243,084 Q73K probably benign Het
Tmem129 G T 5: 33,657,756 probably null Het
Traf3ip3 A T 1: 193,178,291 L441Q probably damaging Het
Ttn C T 2: 76,900,961 probably benign Het
Unc45b T C 11: 82,917,846 S253P possibly damaging Het
Vars2 A G 17: 35,666,258 probably benign Het
Vmn2r51 C T 7: 10,102,445 M136I possibly damaging Het
Vmn2r51 A G 7: 10,102,446 M136T possibly damaging Het
Zfp595 T C 13: 67,317,063 I379V possibly damaging Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7213:Slco6c1 UTSW 1 97127946 missense probably benign
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAGAATCGGACTAGAGCATTGGAAGG -3'
(R):5'- ACAAAGTACAACTGTTGTTGAAGAATTTGCAT -3'

Sequencing Primer
(F):5'- GTCTTTAGCATTATCAAAGAAGGGG -3'
(R):5'- ACATAACTCACTTTAACTTCCATGAC -3'
Posted On2014-04-13