Incidental Mutation 'R1560:Olfr1216'
ID170535
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89013206 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 286 (Y286C)
Ref Sequence ENSEMBL: ENSMUSP00000149441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect probably damaging
Transcript: ENSMUST00000099800
AA Change: Y286C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: Y286C

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216000
AA Change: Y286C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217000
AA Change: Y286C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAACATCCCGCTATTAAGGTGCTC -3'
(R):5'- AGCCCACAGTTCTGAAGGACGAAG -3'

Sequencing Primer
(F):5'- tgtgtgcgtgtTTATTTCTGTTTTAC -3'
(R):5'- TTCTGAAGGACGAAGGAAAGCTC -3'
Posted On2014-04-13