Incidental Mutation 'R1560:Taf4'
ID170536
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene NameTATA-box binding protein associated factor 4
SynonymsTaf4a, Taf2c1, TAFII130, TAFII135
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location179912152-179976646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 179935953 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 525 (V525A)
Ref Sequence ENSEMBL: ENSMUSP00000038610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
Predicted Effect probably benign
Transcript: ENSMUST00000041618
AA Change: V525A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: V525A

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227325
AA Change: V525A

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179976625 missense unknown
IGL00517:Taf4 APN 2 179924413 splice site probably benign
IGL02159:Taf4 APN 2 179938470 missense probably benign 0.24
IGL02254:Taf4 APN 2 179921184 missense probably benign 0.25
IGL03366:Taf4 APN 2 179935054 missense probably damaging 1.00
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R1267:Taf4 UTSW 2 179929324 missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179933027 missense probably damaging 1.00
R1756:Taf4 UTSW 2 179976531 missense unknown
R1893:Taf4 UTSW 2 179933030 missense probably damaging 0.98
R1932:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R2213:Taf4 UTSW 2 179935890 critical splice donor site probably null
R3896:Taf4 UTSW 2 179932014 missense probably benign 0.45
R4050:Taf4 UTSW 2 179932012 missense probably damaging 1.00
R4448:Taf4 UTSW 2 179935971 missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179924494 missense probably damaging 1.00
R5124:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R6155:Taf4 UTSW 2 179913524 missense probably damaging 1.00
R6238:Taf4 UTSW 2 179932039 missense probably damaging 0.97
R6292:Taf4 UTSW 2 179923987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATCCCAAGTAGGACGCTCAGG -3'
(R):5'- GGTAGCCGTTAGTCAGTGTGACAG -3'

Sequencing Primer
(F):5'- TGTGCAGGTCACCCCATAAG -3'
(R):5'- AAGCCCCTCAGGTTTATTGTAG -3'
Posted On2014-04-13