Incidental Mutation 'R1560:Tbck'
ID170538
Institutional Source Beutler Lab
Gene Symbol Tbck
Ensembl Gene ENSMUSG00000028030
Gene NameTBC1 domain containing kinase
SynonymsA630047E20Rik, C030007I09Rik, 1700120J03Rik
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location132684144-132841688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132838048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 887 (T887A)
Ref Sequence ENSEMBL: ENSMUSP00000129205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169172]
Predicted Effect probably damaging
Transcript: ENSMUST00000169172
AA Change: T887A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129205
Gene: ENSMUSG00000028030
AA Change: T887A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 4.5e-29 PFAM
Pfam:Pkinase 32 273 1.4e-39 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
RHOD 780 886 2.67e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197386
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a protein kinase domain, a Rhodanase-like domain and the Tre-2/Bub2/Cdc16 (TBC) domain. The encoded protein is thought to play a role in actin organization, cell growth and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Tbck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tbck APN 3 132743093 splice site probably null
IGL00492:Tbck APN 3 132722740 missense probably benign 0.00
IGL01020:Tbck APN 3 132727142 nonsense probably null
IGL01111:Tbck APN 3 132694407 missense probably damaging 1.00
IGL01299:Tbck APN 3 132724877 missense probably damaging 0.98
IGL02456:Tbck APN 3 132734714 splice site probably benign
IGL02554:Tbck APN 3 132751192 nonsense probably null
IGL02640:Tbck APN 3 132774486 missense probably benign 0.26
IGL02960:Tbck APN 3 132722783 missense probably benign 0.01
IGL03184:Tbck APN 3 132736103 missense probably damaging 1.00
IGL03246:Tbck APN 3 132774570 missense probably benign
fear-4 UTSW 3 132724916 critical splice donor site probably null
fuerchte UTSW 3 132722291 splice site probably benign
PIT1430001:Tbck UTSW 3 132722726 missense probably benign
PIT4802001:Tbck UTSW 3 132752666 missense probably damaging 1.00
R0113:Tbck UTSW 3 132743080 missense probably damaging 1.00
R0241:Tbck UTSW 3 132724875 missense probably benign
R0241:Tbck UTSW 3 132724875 missense probably benign
R0309:Tbck UTSW 3 132734407 nonsense probably null
R0375:Tbck UTSW 3 132751232 splice site probably benign
R0571:Tbck UTSW 3 132752642 missense probably damaging 1.00
R0831:Tbck UTSW 3 132722291 splice site probably benign
R1135:Tbck UTSW 3 132732191 missense probably damaging 0.97
R1184:Tbck UTSW 3 132837972 missense probably benign 0.01
R1563:Tbck UTSW 3 132715693 missense possibly damaging 0.94
R1659:Tbck UTSW 3 132734355 missense probably damaging 1.00
R1799:Tbck UTSW 3 132774502 missense probably benign 0.01
R1830:Tbck UTSW 3 132838011 missense probably benign 0.40
R1884:Tbck UTSW 3 132724916 critical splice donor site probably null
R3406:Tbck UTSW 3 132727084 missense probably benign 0.41
R4021:Tbck UTSW 3 132727134 missense probably damaging 0.97
R4205:Tbck UTSW 3 132838028 missense probably benign 0.32
R4503:Tbck UTSW 3 132751220 missense probably benign 0.03
R4794:Tbck UTSW 3 132686968 missense possibly damaging 0.90
R4795:Tbck UTSW 3 132707798 missense possibly damaging 0.95
R4859:Tbck UTSW 3 132801527 missense probably benign 0.00
R5282:Tbck UTSW 3 132751216 missense possibly damaging 0.95
R5787:Tbck UTSW 3 132737568 missense probably damaging 1.00
R5987:Tbck UTSW 3 132801517 missense possibly damaging 0.53
R6145:Tbck UTSW 3 132732215 missense probably damaging 1.00
R6147:Tbck UTSW 3 132694446 missense probably benign
R6242:Tbck UTSW 3 132694428 missense probably benign 0.16
R6276:Tbck UTSW 3 132743005 missense probably damaging 1.00
R6912:Tbck UTSW 3 132686942 missense possibly damaging 0.50
R7107:Tbck UTSW 3 132722331 missense possibly damaging 0.73
X0018:Tbck UTSW 3 132686800 start codon destroyed probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCTTGGAGAGAGGCTAACCAAC -3'
(R):5'- AGGCGACCATTTGAGTCACGATTTC -3'

Sequencing Primer
(F):5'- GGAAGAGCTTATTCTCTACAGCC -3'
(R):5'- TGAGTCACGATTTCCAAAAGC -3'
Posted On2014-04-13