Incidental Mutation 'R1560:Washc4'
ID170561
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83556109 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 220 (Y220H)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably damaging
Transcript: ENSMUST00000038388
AA Change: Y220H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: Y220H

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCATCACTTGCTATGATCTGGCAC -3'
(R):5'- TGCTCATGAAAACACTGGACAGGG -3'

Sequencing Primer
(F):5'- CATTTGAGGGTAAGACCTGAATC -3'
(R):5'- catccaatcccctcttaccc -3'
Posted On2014-04-13