Incidental Mutation 'R1560:Otop3'
ID170566
Institutional Source Beutler Lab
Gene Symbol Otop3
Ensembl Gene ENSMUSG00000018862
Gene Nameotopetrin 3
Synonyms2310011E08Rik
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115334731-115346927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115344463 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 307 (H307L)
Ref Sequence ENSEMBL: ENSMUSP00000102153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000044152] [ENSMUST00000106542] [ENSMUST00000106543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019006
AA Change: H326L

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862
AA Change: H326L

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044152
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106542
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106543
AA Change: H307L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862
AA Change: H307L

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146256
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Hmbs T C 9: 44,337,360 H72R possibly damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Otop3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Otop3 APN 11 115344453 missense probably benign
IGL00159:Otop3 APN 11 115344397 missense probably damaging 1.00
IGL01372:Otop3 APN 11 115345104 missense possibly damaging 0.86
IGL01380:Otop3 APN 11 115346411 missense probably damaging 1.00
IGL01960:Otop3 APN 11 115340969 missense probably damaging 0.97
IGL03099:Otop3 APN 11 115339582 missense probably damaging 0.99
F5770:Otop3 UTSW 11 115344838 missense probably damaging 1.00
R2847:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R2849:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R5582:Otop3 UTSW 11 115339339 missense unknown
R6383:Otop3 UTSW 11 115345072 missense probably damaging 0.99
R6601:Otop3 UTSW 11 115339847 missense probably damaging 0.98
V7580:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7581:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7582:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7583:Otop3 UTSW 11 115344838 missense probably damaging 1.00
X0022:Otop3 UTSW 11 115339867 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTAACGGGACCAACACTTGC -3'
(R):5'- CAGGCCCTCGATGATGAAGAGATTC -3'

Sequencing Primer
(F):5'- CATGTGCCTCAACACCACAG -3'
(R):5'- AAGTAGGCGATGCCCATCTG -3'
Posted On2014-04-13