Incidental Mutation 'R1561:Ckap2l'
ID170587
Institutional Source Beutler Lab
Gene Symbol Ckap2l
Ensembl Gene ENSMUSG00000048327
Gene Namecytoskeleton associated protein 2-like
Synonyms
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R1561 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129268210-129297212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129270725 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 621 (T621I)
Ref Sequence ENSEMBL: ENSMUSP00000056145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052708]
Predicted Effect probably benign
Transcript: ENSMUST00000052708
AA Change: T621I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: T621I

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:CKAP2_C 425 644 3e-32 PFAM
Pfam:CKAP2_C 675 734 6.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141964
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Ckap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Ckap2l APN 2 129269216 missense probably damaging 1.00
IGL02120:Ckap2l APN 2 129285622 missense possibly damaging 0.58
IGL03085:Ckap2l APN 2 129285047 missense probably benign 0.00
IGL03175:Ckap2l APN 2 129285517 missense probably benign 0.01
IGL03333:Ckap2l APN 2 129296308 splice site probably null
R0196:Ckap2l UTSW 2 129285422 missense probably benign 0.43
R0501:Ckap2l UTSW 2 129285491 missense possibly damaging 0.78
R0715:Ckap2l UTSW 2 129285716 missense probably benign 0.02
R0834:Ckap2l UTSW 2 129296304 splice site probably benign
R1119:Ckap2l UTSW 2 129272572 splice site probably benign
R1677:Ckap2l UTSW 2 129285167 missense possibly damaging 0.86
R1823:Ckap2l UTSW 2 129275579 missense probably damaging 1.00
R1971:Ckap2l UTSW 2 129285422 missense possibly damaging 0.92
R4803:Ckap2l UTSW 2 129269256 missense probably damaging 1.00
R5214:Ckap2l UTSW 2 129285469 missense probably benign 0.02
R5264:Ckap2l UTSW 2 129285379 missense probably benign 0.01
R5297:Ckap2l UTSW 2 129285370 missense possibly damaging 0.56
R5535:Ckap2l UTSW 2 129285842 missense probably benign 0.00
R5606:Ckap2l UTSW 2 129286039 missense probably damaging 0.98
R6327:Ckap2l UTSW 2 129285494 missense probably damaging 1.00
R6489:Ckap2l UTSW 2 129269114 missense possibly damaging 0.85
R6726:Ckap2l UTSW 2 129269194 missense probably damaging 1.00
R7199:Ckap2l UTSW 2 129285055 missense probably benign 0.25
R7220:Ckap2l UTSW 2 129275516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACCACACCTGAAGCAGAGGTC -3'
(R):5'- AGTCCATGAGGGTTACTGGGAATCG -3'

Sequencing Primer
(F):5'- AGGTCTCTAAACTGCTTCTCGG -3'
(R):5'- TGTGTGCACAGCAGTAACCT -3'
Posted On2014-04-13