Incidental Mutation 'R1561:Vmn1r42'
ID170605
Institutional Source Beutler Lab
Gene Symbol Vmn1r42
Ensembl Gene ENSMUSG00000068232
Gene Namevomeronasal 1 receptor 42
SynonymsV1ra6
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1561 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89842573-89876413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89845381 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 69 (G69S)
Ref Sequence ENSEMBL: ENSMUSP00000154442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089419] [ENSMUST00000226436] [ENSMUST00000227279]
Predicted Effect probably damaging
Transcript: ENSMUST00000089419
AA Change: G69S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086840
Gene: ENSMUSG00000068232
AA Change: G69S

DomainStartEndE-ValueType
Pfam:V1R 54 318 3.6e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226436
AA Change: G69S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227279
AA Change: G69S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Vmn1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Vmn1r42 APN 6 89845589 utr 5 prime probably benign
IGL02151:Vmn1r42 APN 6 89845041 missense possibly damaging 0.90
IGL02158:Vmn1r42 APN 6 89845314 missense probably damaging 0.96
IGL02731:Vmn1r42 APN 6 89845425 missense probably benign 0.41
IGL02738:Vmn1r42 APN 6 89844648 missense possibly damaging 0.69
IGL02817:Vmn1r42 APN 6 89845536 missense probably damaging 1.00
volkan UTSW 6 89844967 missense probably benign 0.00
R1131:Vmn1r42 UTSW 6 89845569 missense possibly damaging 0.88
R1500:Vmn1r42 UTSW 6 89845501 missense probably benign 0.01
R1557:Vmn1r42 UTSW 6 89844751 missense possibly damaging 0.66
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1574:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1857:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1858:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1916:Vmn1r42 UTSW 6 89844967 missense probably benign 0.00
R2284:Vmn1r42 UTSW 6 89844699 missense probably benign 0.26
R2912:Vmn1r42 UTSW 6 89844706 missense probably benign
R4541:Vmn1r42 UTSW 6 89845551 missense probably benign
R5085:Vmn1r42 UTSW 6 89844616 missense probably benign 0.00
R5384:Vmn1r42 UTSW 6 89845384 missense probably damaging 1.00
R5616:Vmn1r42 UTSW 6 89845102 missense possibly damaging 0.66
R5647:Vmn1r42 UTSW 6 89845332 missense probably benign 0.43
R5867:Vmn1r42 UTSW 6 89844779 nonsense probably null
R6569:Vmn1r42 UTSW 6 89845443 missense probably damaging 1.00
R6852:Vmn1r42 UTSW 6 89844787 missense possibly damaging 0.71
R7054:Vmn1r42 UTSW 6 89845069 missense possibly damaging 0.90
R7399:Vmn1r42 UTSW 6 89845513 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CAACATGCTGGTGGTGCAAAGG -3'
(R):5'- TAGGACACAGGATCGAGCCATGAC -3'

Sequencing Primer
(F):5'- TGCAAAGGGAGAAACCCCTC -3'
(R):5'- GAGCCATGACTCAGCTTTGAAC -3'
Posted On2014-04-13