Incidental Mutation 'R1561:Atg7'
ID170606
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Nameautophagy related 7
Synonyms1810013K23Rik, Apg7l
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1561 (G1)
Quality Score215
Status Not validated
Chromosome6
Chromosomal Location114643097-114860614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114701172 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 341 (V341A)
Ref Sequence ENSEMBL: ENSMUSP00000133215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182428] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
Predicted Effect probably benign
Transcript: ENSMUST00000032457
AA Change: V298A

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314
AA Change: V298A

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169310
AA Change: V341A

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314
AA Change: V341A

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182428
AA Change: V298A

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314
AA Change: V298A

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182793
AA Change: V298A

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314
AA Change: V298A

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182902
AA Change: V298A

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314
AA Change: V298A

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183165
AA Change: V259A

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314
AA Change: V259A

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203130
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114724923 missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114703364 missense probably damaging 0.99
R1467:Atg7 UTSW 6 114858982 splice site probably benign
R1755:Atg7 UTSW 6 114673677 missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114701235 missense probably damaging 0.98
R1962:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R1964:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R2064:Atg7 UTSW 6 114703363 missense probably damaging 1.00
R3722:Atg7 UTSW 6 114695663 missense probably damaging 0.99
R3870:Atg7 UTSW 6 114697047 missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114701978 missense probably benign 0.00
R4111:Atg7 UTSW 6 114713294 missense probably damaging 0.98
R4212:Atg7 UTSW 6 114703425 missense probably benign 0.02
R4943:Atg7 UTSW 6 114697084 missense probably benign 0.25
R5216:Atg7 UTSW 6 114724949 missense probably damaging 0.96
R5465:Atg7 UTSW 6 114652532 missense probably benign
R5555:Atg7 UTSW 6 114702053 missense probably damaging 1.00
R5618:Atg7 UTSW 6 114673699 missense probably damaging 0.99
R5902:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R5903:Atg7 UTSW 6 114706293 nonsense probably null
R5980:Atg7 UTSW 6 114680236 missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6178:Atg7 UTSW 6 114724895 missense probably damaging 1.00
R6702:Atg7 UTSW 6 114671097 splice site probably null
R6924:Atg7 UTSW 6 114709211 critical splice donor site probably null
R6941:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114777057 missense probably damaging 1.00
Z1088:Atg7 UTSW 6 114695686 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGGAAATAGCAAAGCTCTGGGACTG -3'
(R):5'- ACAATGATCGCTCAGCTACGCAG -3'

Sequencing Primer
(F):5'- cctaatggtggctcaaaactc -3'
(R):5'- CTACGCAGGAACAGCATTG -3'
Posted On2014-04-13