Incidental Mutation 'R1561:Cmip'
ID170612
Institutional Source Beutler Lab
Gene Symbol Cmip
Ensembl Gene ENSMUSG00000034390
Gene Namec-Maf inducing protein
Synonyms
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1561 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117257064-117459430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117453850 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 554 (T554A)
Ref Sequence ENSEMBL: ENSMUSP00000092795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095172] [ENSMUST00000166750]
Predicted Effect probably benign
Transcript: ENSMUST00000095172
AA Change: T554A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092795
Gene: ENSMUSG00000034390
AA Change: T554A

DomainStartEndE-ValueType
Blast:PH 13 70 5e-33 BLAST
low complexity region 71 79 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
SCOP:d1a9na_ 564 681 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166750
AA Change: T642A

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130264
Gene: ENSMUSG00000034390
AA Change: T642A

DomainStartEndE-ValueType
PH 54 163 2.71e-1 SMART
low complexity region 394 407 N/A INTRINSIC
SCOP:d1a9na_ 652 769 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212884
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Cmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Cmip APN 8 117445328 missense probably benign 0.29
IGL02126:Cmip APN 8 117449031 missense probably damaging 0.99
IGL02205:Cmip APN 8 117454975 missense probably damaging 1.00
IGL02352:Cmip APN 8 117411255 splice site probably benign
IGL02359:Cmip APN 8 117411255 splice site probably benign
IGL02558:Cmip APN 8 117449088 missense probably damaging 0.99
R0070:Cmip UTSW 8 117426554 missense probably damaging 0.99
R0335:Cmip UTSW 8 117445366 missense probably damaging 0.99
R1225:Cmip UTSW 8 117445371 missense probably damaging 0.98
R2508:Cmip UTSW 8 117436693 missense probably benign
R2885:Cmip UTSW 8 117384965 missense probably benign 0.01
R3415:Cmip UTSW 8 117349377 critical splice donor site probably null
R4024:Cmip UTSW 8 117447416 missense possibly damaging 0.79
R4168:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4169:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4632:Cmip UTSW 8 117447411 missense possibly damaging 0.88
R4706:Cmip UTSW 8 117377154 missense probably damaging 0.99
R4924:Cmip UTSW 8 117257255 missense probably benign 0.00
R5380:Cmip UTSW 8 117422890 missense probably damaging 0.99
R5927:Cmip UTSW 8 117257309 missense possibly damaging 0.85
R6212:Cmip UTSW 8 117377156 missense probably damaging 1.00
R6310:Cmip UTSW 8 117429810 missense possibly damaging 0.63
R6747:Cmip UTSW 8 117436879 missense probably benign 0.02
R6881:Cmip UTSW 8 117436595 missense possibly damaging 0.77
R6968:Cmip UTSW 8 117377156 missense probably damaging 1.00
R7003:Cmip UTSW 8 117384988 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GACATCGCCTTCCATCAGAGCATC -3'
(R):5'- GGCGTTGGAGCTAGAGTCTTACAC -3'

Sequencing Primer
(F):5'- GCATCTAAACGTCCAGCTCTG -3'
(R):5'- CACAGGTTAAATGTGTGCTCTACC -3'
Posted On2014-04-13