Incidental Mutation 'R1561:Mrnip'
ID170621
Institutional Source Beutler Lab
Gene Symbol Mrnip
Ensembl Gene ENSMUSG00000020381
Gene NameMRN complex interacting protein
Synonyms3010026O09Rik
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1561 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50174444-50200115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50176849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 30 (T30I)
Ref Sequence ENSEMBL: ENSMUSP00000020647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020647] [ENSMUST00000093138] [ENSMUST00000101270] [ENSMUST00000123164]
Predicted Effect probably damaging
Transcript: ENSMUST00000020647
AA Change: T30I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000093138
SMART Domains Protein: ENSMUSP00000090825
Gene: ENSMUSG00000036644

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 2e-28 BLAST
low complexity region 1124 1138 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101270
SMART Domains Protein: ENSMUSP00000098828
Gene: ENSMUSG00000036644

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 3e-28 BLAST
low complexity region 970 980 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
low complexity region 1161 1172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123164
AA Change: T23I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143480
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Mrnip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Mrnip APN 11 50197635 missense probably damaging 0.99
IGL01836:Mrnip APN 11 50199848 missense probably benign 0.01
IGL02080:Mrnip APN 11 50197675 missense probably benign 0.00
IGL03059:Mrnip APN 11 50199769 missense probably damaging 1.00
IGL03381:Mrnip APN 11 50199590 missense probably benign
R0391:Mrnip UTSW 11 50199920 missense probably damaging 0.99
R1388:Mrnip UTSW 11 50196945 missense probably benign 0.02
R1736:Mrnip UTSW 11 50176891 splice site probably null
R1768:Mrnip UTSW 11 50176861 missense probably damaging 1.00
R5660:Mrnip UTSW 11 50197091 missense probably null 1.00
R6505:Mrnip UTSW 11 50199852 missense possibly damaging 0.92
R6803:Mrnip UTSW 11 50199903 missense probably benign
R7290:Mrnip UTSW 11 50196981 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGGATGGCAAAACTCCAACTGGATG -3'
(R):5'- ACAGACCCTGTGTAGTCACTGCTC -3'

Sequencing Primer
(F):5'- CCAACTGGATGTTTGTTGTTTCATAC -3'
(R):5'- GCTCCACCCACTGACGATG -3'
Posted On2014-04-13