Incidental Mutation 'R1561:Trappc8'
ID170642
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Nametrafficking protein particle complex 8
SynonymsD030074E01Rik, Trs85, 5033403J15Rik
MMRRC Submission 039600-MU
Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1561 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20817223-20896093 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 20841623 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 883 (R883*)
Ref Sequence ENSEMBL: ENSMUSP00000153183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000097658] [ENSMUST00000225661]
Predicted Effect probably null
Transcript: ENSMUST00000025177
AA Change: R884*
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: R884*

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097658
SMART Domains Protein: ENSMUSP00000095262
Gene: ENSMUSG00000033382

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 152 605 9.3e-135 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223584
Predicted Effect probably null
Transcript: ENSMUST00000225661
AA Change: R883*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc2a1 A G 4: 119,136,409 E481G possibly damaging Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20836978 missense probably benign 0.20
IGL01367:Trappc8 APN 18 20866119 missense probably benign 0.01
IGL01537:Trappc8 APN 18 20835004 missense probably benign
IGL01563:Trappc8 APN 18 20837046 missense probably benign 0.00
IGL01982:Trappc8 APN 18 20874712 splice site probably benign
IGL02709:Trappc8 APN 18 20837178 missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20863595 missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20820935 missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20852781 missense probably damaging 1.00
hoppa UTSW 18 20836900 missense probably benign 0.05
lagomorpha UTSW 18 20818190 missense probably benign 0.11
rabbit UTSW 18 20874680 missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20850918 missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20845601 missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20866186 missense probably benign 0.07
R0506:Trappc8 UTSW 18 20844188 missense possibly damaging 0.49
R0610:Trappc8 UTSW 18 20837188 missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20831608 critical splice donor site probably null
R1589:Trappc8 UTSW 18 20863551 missense probably damaging 1.00
R1700:Trappc8 UTSW 18 20832998 missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20834940 splice site probably null
R1786:Trappc8 UTSW 18 20834940 splice site probably null
R1989:Trappc8 UTSW 18 20845651 missense probably benign 0.04
R2181:Trappc8 UTSW 18 20819222 critical splice donor site probably null
R2294:Trappc8 UTSW 18 20866154 nonsense probably null
R4551:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R4594:Trappc8 UTSW 18 20836948 missense probably benign
R4631:Trappc8 UTSW 18 20867808 missense probably benign 0.22
R4734:Trappc8 UTSW 18 20841572 nonsense probably null
R4834:Trappc8 UTSW 18 20825065 missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20844180 missense probably benign 0.04
R5262:Trappc8 UTSW 18 20818190 missense probably benign 0.11
R5384:Trappc8 UTSW 18 20833062 intron probably null
R5476:Trappc8 UTSW 18 20865108 missense probably damaging 1.00
R5503:Trappc8 UTSW 18 20836900 missense probably benign 0.05
R5577:Trappc8 UTSW 18 20836779 nonsense probably null
R5809:Trappc8 UTSW 18 20818082 missense probably benign 0.08
R5825:Trappc8 UTSW 18 20873920 missense probably damaging 1.00
R5886:Trappc8 UTSW 18 20874680 missense probably damaging 1.00
R5936:Trappc8 UTSW 18 20874688 missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20833009 missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20846447 critical splice donor site probably null
R6229:Trappc8 UTSW 18 20870745 missense probably benign 0.00
R6376:Trappc8 UTSW 18 20837075 missense probably benign 0.07
R6403:Trappc8 UTSW 18 20866071 missense probably benign
R6459:Trappc8 UTSW 18 20836868 missense probably benign 0.40
R6673:Trappc8 UTSW 18 20885257 missense probably benign 0.01
R7041:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R7276:Trappc8 UTSW 18 20818091 missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20852647 missense probably damaging 1.00
X0065:Trappc8 UTSW 18 20860522 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATTCTGTGAAACATCATCTGGCTCTG -3'
(R):5'- GCCTTTGGTGAAACCCCACATAGATAC -3'

Sequencing Primer
(F):5'- ACATCATCTGGCTCTGTAATTGTTTG -3'
(R):5'- CAGTGAGACATTGAATAGCATACC -3'
Posted On2014-04-13