Incidental Mutation 'R1562:Cenpe'
ID170660
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 039601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1562 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135238394 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 985 (M985T)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062893
AA Change: M985T

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: M985T

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Folr1 T G 7: 101,858,594 D213A probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rlf A T 4: 121,150,391 M574K possibly damaging Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Vmn2r4 G T 3: 64,389,444 T640N probably damaging Het
Wdr75 T A 1: 45,803,870 probably null Het
Zdbf2 T G 1: 63,303,588 S375R possibly damaging Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Zfp964 C T 8: 69,663,004 P85S probably benign Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GACCAACTCAGAAGTGACATTCAGGAC -3'
(R):5'- CCTTAAAAGACTGCTGTTACCTCAGGC -3'

Sequencing Primer
(F):5'- TGACATTCAGGACACTGTGAAC -3'
(R):5'- gaagaaacagatcagaggcaac -3'
Posted On2014-04-13