Incidental Mutation 'R1562:Zfp964'
ID170681
Institutional Source Beutler Lab
Gene Symbol Zfp964
Ensembl Gene ENSMUSG00000091764
Gene Namezinc finger protein 964
SynonymsGm7187
MMRRC Submission 039601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1562 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69654479-69666982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69663004 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 85 (P85S)
Ref Sequence ENSEMBL: ENSMUSP00000145354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169125] [ENSMUST00000204285]
Predicted Effect probably benign
Transcript: ENSMUST00000169125
AA Change: P84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129822
Gene: ENSMUSG00000091764
AA Change: P84S

DomainStartEndE-ValueType
KRAB 3 56 5.24e-18 SMART
ZnF_C2H2 216 238 4.54e-4 SMART
ZnF_C2H2 244 266 3.58e-2 SMART
ZnF_C2H2 272 294 2.2e-2 SMART
ZnF_C2H2 300 322 5.5e-3 SMART
ZnF_C2H2 328 350 8.22e-2 SMART
ZnF_C2H2 356 378 2.05e-2 SMART
ZnF_C2H2 384 406 6.32e-3 SMART
ZnF_C2H2 412 434 5.42e-2 SMART
ZnF_C2H2 440 462 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204062
Predicted Effect probably benign
Transcript: ENSMUST00000204285
AA Change: P85S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145354
Gene: ENSMUSG00000091764
AA Change: P85S

DomainStartEndE-ValueType
KRAB 4 57 5.24e-18 SMART
ZnF_C2H2 217 239 4.54e-4 SMART
ZnF_C2H2 245 267 3.58e-2 SMART
ZnF_C2H2 273 295 2.2e-2 SMART
ZnF_C2H2 301 323 5.5e-3 SMART
ZnF_C2H2 329 351 8.22e-2 SMART
ZnF_C2H2 357 379 2.05e-2 SMART
ZnF_C2H2 385 407 6.32e-3 SMART
ZnF_C2H2 413 435 5.42e-2 SMART
ZnF_C2H2 441 463 1.28e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,198 I134F probably damaging Het
Abca2 A G 2: 25,446,319 I2201V probably benign Het
Adam22 T C 5: 8,095,007 N817S probably damaging Het
Alox12 C A 11: 70,250,165 R348L probably damaging Het
Asb17 A T 3: 153,853,506 T285S probably benign Het
Casp4 T C 9: 5,324,733 S182P possibly damaging Het
Cenpe T C 3: 135,238,394 M985T possibly damaging Het
Clcn1 C T 6: 42,300,235 P420L probably benign Het
Coro2a T C 4: 46,548,917 I126V probably benign Het
Cubn T C 2: 13,427,967 Y1181C probably damaging Het
Cyp2d22 A T 15: 82,373,978 L147Q probably damaging Het
D430042O09Rik C A 7: 125,842,848 S643Y probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Fat2 T C 11: 55,309,974 N758S probably damaging Het
Fbxo43 T C 15: 36,163,016 D15G probably damaging Het
Flt3 T C 5: 147,344,513 E803G probably damaging Het
Folr1 T G 7: 101,858,594 D213A probably damaging Het
Fus T C 7: 127,979,922 V359A probably damaging Het
Gabrb3 C T 7: 57,765,514 R111* probably null Het
Gm17324 T C 9: 78,448,682 probably benign Het
Hormad2 A T 11: 4,408,848 probably null Het
Ifi27l2b T A 12: 103,456,521 probably null Het
Isg20 G T 7: 78,920,143 C176F probably benign Het
Krt15 C A 11: 100,133,181 V346L probably benign Het
Med13l A G 5: 118,738,519 K920R probably damaging Het
Mlh3 A T 12: 85,266,920 F831I probably benign Het
Mtmr9 A G 14: 63,534,337 S267P probably benign Het
Mybpc1 C T 10: 88,553,331 A406T probably damaging Het
Myh1 T C 11: 67,211,370 M829T probably benign Het
Myo10 A G 15: 25,780,411 Q209R possibly damaging Het
Nceh1 T A 3: 27,239,552 V153D probably damaging Het
Olfr1195 T A 2: 88,683,079 I218F probably benign Het
Olfr348 A G 2: 36,786,684 D53G probably damaging Het
Olfr694 C T 7: 106,688,980 M250I probably benign Het
Olfr898 C A 9: 38,349,362 S87* probably null Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pcnt G A 10: 76,367,330 T2646M probably benign Het
Phf10 A T 17: 14,946,250 C453S probably damaging Het
Plcb4 T A 2: 135,970,447 probably null Het
Plekhh1 A G 12: 79,076,708 H1185R probably benign Het
Prmt3 G T 7: 49,826,854 V404L probably benign Het
Ptprb T A 10: 116,339,467 D1122E probably benign Het
Rars A G 11: 35,821,094 probably null Het
Rasa2 G T 9: 96,545,750 N687K possibly damaging Het
Rbm11 A G 16: 75,596,535 T40A probably damaging Het
Rem2 T C 14: 54,476,318 V16A probably benign Het
Rlf A T 4: 121,150,391 M574K possibly damaging Het
Rpap3 A T 15: 97,694,217 V186D possibly damaging Het
Sertad3 G A 7: 27,476,623 E161K probably damaging Het
Sh3gl2 T C 4: 85,385,893 S278P probably benign Het
Strn3 T C 12: 51,633,618 T400A probably benign Het
Sycp2 A T 2: 178,382,385 I402N probably damaging Het
Synj1 C T 16: 90,987,402 V283I probably benign Het
Tas2r108 A G 6: 40,494,066 probably null Het
Ttpal A G 2: 163,615,403 N265S probably benign Het
Unc80 G A 1: 66,637,957 G2015D probably damaging Het
Upf1 C T 8: 70,343,367 W138* probably null Het
Vmn1r25 T G 6: 57,978,801 M168L probably benign Het
Vmn2r18 A T 5: 151,586,836 F24Y probably benign Het
Vmn2r4 G T 3: 64,389,444 T640N probably damaging Het
Wdr75 T A 1: 45,803,870 probably null Het
Zdbf2 T G 1: 63,303,588 S375R possibly damaging Het
Zfp648 A G 1: 154,204,392 Q99R probably benign Het
Other mutations in Zfp964
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Zfp964 APN 8 69659393 splice site probably null
R0506:Zfp964 UTSW 8 69663937 missense unknown
R0740:Zfp964 UTSW 8 69663178 missense probably damaging 0.98
R0786:Zfp964 UTSW 8 69664081 missense possibly damaging 0.71
R1158:Zfp964 UTSW 8 69663853 missense unknown
R1204:Zfp964 UTSW 8 69664018 missense probably benign 0.08
R1413:Zfp964 UTSW 8 69663070 missense unknown
R1663:Zfp964 UTSW 8 69664083 synonymous probably null
R1693:Zfp964 UTSW 8 69664150 missense possibly damaging 0.55
R2029:Zfp964 UTSW 8 69663917 missense unknown
R2847:Zfp964 UTSW 8 69663854 missense unknown
R2849:Zfp964 UTSW 8 69663854 missense unknown
R4111:Zfp964 UTSW 8 69664104 missense probably benign 0.18
R4792:Zfp964 UTSW 8 69664015 missense probably benign 0.18
R4907:Zfp964 UTSW 8 69663322 missense possibly damaging 0.86
R4938:Zfp964 UTSW 8 69664108 missense possibly damaging 0.64
R5688:Zfp964 UTSW 8 69664116 missense probably benign 0.03
R5905:Zfp964 UTSW 8 69663913 missense unknown
R6009:Zfp964 UTSW 8 69663456 missense possibly damaging 0.71
R6021:Zfp964 UTSW 8 69663092 missense unknown
R6028:Zfp964 UTSW 8 69663913 missense unknown
R6374:Zfp964 UTSW 8 69659344 missense possibly damaging 0.93
R6583:Zfp964 UTSW 8 69662983 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCACATGCTCACAGGGTGTGAAG -3'
(R):5'- GTTCTCATGTACCGCTGAAAGGTTCTC -3'

Sequencing Primer
(F):5'- agagtcagcatataggacatcag -3'
(R):5'- CAGAGAATCAGAGTTATACTGCTTGG -3'
Posted On2014-04-13