Incidental Mutation 'R1563:Tlr5'
ID170724
Institutional Source Beutler Lab
Gene Symbol Tlr5
Ensembl Gene ENSMUSG00000079164
Gene Nametoll-like receptor 5
Synonyms
MMRRC Submission 039602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1563 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location182954788-182976044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 182975010 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 626 (M626I)
Ref Sequence ENSEMBL: ENSMUSP00000141318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]
Predicted Effect probably benign
Transcript: ENSMUST00000110997
AA Change: M626I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: M626I

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 3.11e-2 SMART
LRR 159 183 5.56e0 SMART
LRR 184 207 1.97e2 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 7.05e-1 SMART
LRR 350 373 2.92e1 SMART
LRR 374 397 2.54e1 SMART
LRR 398 418 1.29e2 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 1.06e-4 SMART
LRR 540 563 6.13e-1 SMART
LRR 564 585 2.21e2 SMART
LRRCT 594 645 7.01e-6 SMART
low complexity region 657 676 N/A INTRINSIC
TIR 707 852 3.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191820
AA Change: M612I

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: M612I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
LRR_TYP 95 118 1.3e-4 SMART
LRR 145 169 2.3e-2 SMART
LRR 170 193 8.2e-1 SMART
low complexity region 248 261 N/A INTRINSIC
LRR 312 335 2.9e-3 SMART
LRR 336 359 1.2e-1 SMART
LRR 360 383 1.1e-1 SMART
LRR 384 404 5.4e-1 SMART
low complexity region 427 442 N/A INTRINSIC
LRR_TYP 502 525 4.5e-7 SMART
LRR 526 549 2.5e-3 SMART
LRR 550 571 9.4e-1 SMART
LRRCT 580 631 3.4e-8 SMART
transmembrane domain 642 664 N/A INTRINSIC
TIR 693 838 2.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193539
Predicted Effect probably benign
Transcript: ENSMUST00000193687
AA Change: M626I

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: M626I

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 1.3e-4 SMART
LRR 159 183 2.3e-2 SMART
LRR 184 207 8.2e-1 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 2.9e-3 SMART
LRR 350 373 1.2e-1 SMART
LRR 374 397 1.1e-1 SMART
LRR 398 418 5.4e-1 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 4.5e-7 SMART
LRR 540 563 2.5e-3 SMART
LRR 564 585 9.4e-1 SMART
LRRCT 594 645 3.4e-8 SMART
transmembrane domain 656 678 N/A INTRINSIC
TIR 707 852 2.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195614
Meta Mutation Damage Score 0.1668 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr1298 T A 2: 111,645,682 H105L probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tekt2 T A 4: 126,323,407 M233L probably benign Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trhr G A 15: 44,197,101 V6I probably benign Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Vps26a T G 10: 62,464,680 I236L probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zfhx2 A G 14: 55,065,088 V1813A probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Tlr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tlr5 APN 1 182973829 missense probably benign
IGL00940:Tlr5 APN 1 182974196 missense possibly damaging 0.84
IGL01302:Tlr5 APN 1 182974748 missense probably benign 0.00
IGL01480:Tlr5 APN 1 182973499 missense probably benign 0.09
IGL01717:Tlr5 APN 1 182975398 missense probably damaging 1.00
IGL01896:Tlr5 APN 1 182974879 missense possibly damaging 0.64
IGL02083:Tlr5 APN 1 182973884 missense possibly damaging 0.91
IGL02135:Tlr5 APN 1 182973254 missense possibly damaging 0.82
R0464:Tlr5 UTSW 1 182973710 missense probably benign 0.01
R0552:Tlr5 UTSW 1 182975696 unclassified probably null
R0556:Tlr5 UTSW 1 182974151 missense probably damaging 1.00
R0639:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R0670:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R1014:Tlr5 UTSW 1 182975677 missense probably benign 0.00
R1125:Tlr5 UTSW 1 182973892 missense probably benign 0.00
R1775:Tlr5 UTSW 1 182973722 missense probably damaging 0.99
R1793:Tlr5 UTSW 1 182972447 missense probably benign 0.00
R1991:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R1992:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R2114:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2116:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2225:Tlr5 UTSW 1 182972376 start gained probably benign
R2265:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2266:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2268:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2882:Tlr5 UTSW 1 182973893 missense probably damaging 1.00
R3695:Tlr5 UTSW 1 182975347 missense probably damaging 1.00
R3747:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R3749:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R4084:Tlr5 UTSW 1 182974848 missense possibly damaging 0.60
R4794:Tlr5 UTSW 1 182973896 missense probably benign 0.00
R4895:Tlr5 UTSW 1 182974199 missense probably damaging 1.00
R4964:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R4966:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R5496:Tlr5 UTSW 1 182973632 missense probably damaging 1.00
R6056:Tlr5 UTSW 1 182974038 missense possibly damaging 0.76
R6715:Tlr5 UTSW 1 182972659 intron probably benign
R6825:Tlr5 UTSW 1 182973044 intron probably benign
R6961:Tlr5 UTSW 1 182973511 nonsense probably null
R7135:Tlr5 UTSW 1 182975523 missense possibly damaging 0.87
R7232:Tlr5 UTSW 1 182973499 missense probably benign 0.09
R7255:Tlr5 UTSW 1 182974316 missense probably damaging 1.00
R7257:Tlr5 UTSW 1 182974233 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTAACAAGCTGACCGTGCTCTC -3'
(R):5'- ACTCCAGACCTTGTCCTTGAACACC -3'

Sequencing Primer
(F):5'- CCTGCTAATTTAGAGATTCTCGAC -3'
(R):5'- TGAACACCAGCTTCTGGATG -3'
Posted On2014-04-13