Incidental Mutation 'R1563:Olfr1298'
ID170729
Institutional Source Beutler Lab
Gene Symbol Olfr1298
Ensembl Gene ENSMUSG00000109487
Gene Nameolfactory receptor 1298
SynonymsGA_x6K02T2Q125-72697413-72696475, MOR248-6
MMRRC Submission 039602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1563 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111644498-111649201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111645682 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 105 (H105L)
Ref Sequence ENSEMBL: ENSMUSP00000146343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119566] [ENSMUST00000208284]
Predicted Effect probably damaging
Transcript: ENSMUST00000090322
AA Change: H105L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099610
Gene: ENSMUSG00000096853
AA Change: H105L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 6.7e-48 PFAM
Pfam:7tm_1 41 287 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119566
AA Change: H105L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208284
AA Change: H105L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tekt2 T A 4: 126,323,407 M233L probably benign Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tlr5 G A 1: 182,975,010 M626I probably benign Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trhr G A 15: 44,197,101 V6I probably benign Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Vps26a T G 10: 62,464,680 I236L probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zfhx2 A G 14: 55,065,088 V1813A probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Olfr1298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Olfr1298 APN 2 111645256 missense probably damaging 1.00
IGL01571:Olfr1298 APN 2 111645380 missense probably benign 0.00
IGL02605:Olfr1298 APN 2 111645505 missense probably benign 0.00
IGL02652:Olfr1298 APN 2 111645494 missense probably benign 0.16
IGL02669:Olfr1298 APN 2 111645891 nonsense probably null
R0197:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R0701:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R0883:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R1567:Olfr1298 UTSW 2 111645926 missense possibly damaging 0.92
R1740:Olfr1298 UTSW 2 111645869 missense probably damaging 0.97
R2142:Olfr1298 UTSW 2 111645221 missense probably benign 0.04
R3949:Olfr1298 UTSW 2 111645526 missense possibly damaging 0.67
R4766:Olfr1298 UTSW 2 111645881 missense probably benign
R4924:Olfr1298 UTSW 2 111645776 missense possibly damaging 0.87
R7320:Olfr1298 UTSW 2 111645952 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGACCACAGAAAGGAAGCTGCAC -3'
(R):5'- GTTGCTCTTGACTCATGAATTTCCCTTG -3'

Sequencing Primer
(F):5'- GAAAGGAAGCTGCACAACCAC -3'
(R):5'- CAGGTGAGTTCTAATATGGATGCC -3'
Posted On2014-04-13