Incidental Mutation 'R1563:Tekt2'
ID170738
Institutional Source Beutler Lab
Gene Symbol Tekt2
Ensembl Gene ENSMUSG00000028845
Gene Nametektin 2
Synonymstektin-t
MMRRC Submission 039602-MU
Accession Numbers

Genbank: NM_011902.2; Ensembl: ENSMUST00000102616

Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1563 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126322121-126325688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126323407 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 233 (M233L)
Ref Sequence ENSEMBL: ENSMUSP00000099676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
AA Change: M233L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845
AA Change: M233L

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
AA Change: M233L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845
AA Change: M233L

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140080
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156139
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit male infertility and impaired motility of both sperm flagella and tracheal cilia due to altered dynein inner arm morphology and function. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr1298 T A 2: 111,645,682 H105L probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tlr5 G A 1: 182,975,010 M626I probably benign Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trhr G A 15: 44,197,101 V6I probably benign Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Vps26a T G 10: 62,464,680 I236L probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zfhx2 A G 14: 55,065,088 V1813A probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Tekt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tekt2 APN 4 126323189 missense possibly damaging 0.47
IGL01900:Tekt2 APN 4 126324628 missense probably benign 0.00
IGL02452:Tekt2 APN 4 126324852 missense possibly damaging 0.83
IGL02563:Tekt2 APN 4 126324625 missense possibly damaging 0.82
IGL03087:Tekt2 APN 4 126324867 missense possibly damaging 0.63
1mM(1):Tekt2 UTSW 4 126324610 missense probably damaging 0.98
R0747:Tekt2 UTSW 4 126323760 nonsense probably null
R1113:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1308:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1524:Tekt2 UTSW 4 126323649 missense probably benign
R1819:Tekt2 UTSW 4 126323736 missense probably damaging 1.00
R1930:Tekt2 UTSW 4 126322817 splice site probably null
R1931:Tekt2 UTSW 4 126322817 splice site probably null
R2295:Tekt2 UTSW 4 126323693 unclassified probably null
R4888:Tekt2 UTSW 4 126324667 missense probably benign 0.02
R4902:Tekt2 UTSW 4 126323470 missense possibly damaging 0.95
R5202:Tekt2 UTSW 4 126324670 missense probably benign 0.41
R5219:Tekt2 UTSW 4 126322264 missense possibly damaging 0.51
R5839:Tekt2 UTSW 4 126322836 missense probably damaging 1.00
R6213:Tekt2 UTSW 4 126323196 missense probably damaging 0.99
R6498:Tekt2 UTSW 4 126324305 missense probably benign 0.01
R6963:Tekt2 UTSW 4 126324317 missense probably damaging 0.98
R6988:Tekt2 UTSW 4 126323443 missense probably benign 0.02
R7148:Tekt2 UTSW 4 126322381 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACCCTCTGAGCGTCCAGTTCATTG -3'
(R):5'- TCGGCAGCAACTCAACTCTGAC -3'

Sequencing Primer
(F):5'- CCAGTTCATTGTTGGTCTGC -3'
(R):5'- AAGACCAGTGTTTCAGTCAGTCC -3'
Posted On2014-04-13