Incidental Mutation 'R1563:Vps26a'
ID170764
Institutional Source Beutler Lab
Gene Symbol Vps26a
Ensembl Gene ENSMUSG00000020078
Gene NameVPS26 retromer complex component A
SynonymsVps26, H beta 58, HB58
MMRRC Submission 039602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1563 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62455235-62486805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62464680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 236 (I236L)
Ref Sequence ENSEMBL: ENSMUSP00000090130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092473] [ENSMUST00000105447] [ENSMUST00000217868] [ENSMUST00000219574]
PDB Structure
Structure of mouse VPS26A bound to rat SNX27 PDZ domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000092473
AA Change: I236L

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090130
Gene: ENSMUSG00000020078
AA Change: I236L

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
Pfam:Vps26 40 315 3.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105447
AA Change: I204L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101087
Gene: ENSMUSG00000020078
AA Change: I204L

DomainStartEndE-ValueType
Pfam:Vps26 8 283 2.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217868
Predicted Effect probably benign
Transcript: ENSMUST00000219574
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null mutation induced by transgene insertion exhibit retarded growth of the embryonic ectoderm beginning at embryonic day 7.5 and often, defects of the amnion and chorion. Mutant embryos arrest about day 9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,719,534 Y707C probably damaging Het
4930519G04Rik T C 5: 114,863,508 M22T probably benign Het
A930018M24Rik A G 14: 50,897,119 L22P probably damaging Het
Aipl1 A T 11: 72,036,712 M59K probably damaging Het
Atg2b T C 12: 105,623,488 I1835V probably damaging Het
Cacna1i T C 15: 80,321,188 V115A probably damaging Het
Cacna1i A T 15: 80,389,855 probably benign Het
Catsperb T A 12: 101,588,102 M685K probably damaging Het
Cdh10 T A 15: 18,986,767 Y361* probably null Het
Clcn4 C T 7: 7,293,982 C219Y probably damaging Het
Cpeb2 G A 5: 43,285,737 V924M probably damaging Het
Cpxm2 T C 7: 132,143,682 E138G probably benign Het
Dennd1a T C 2: 37,858,429 Y346C probably damaging Het
Dnah8 T A 17: 30,635,664 L100Q probably benign Het
Dnajc6 A C 4: 101,599,137 N76T probably damaging Het
Ehbp1 A G 11: 22,059,231 L954P probably damaging Het
Eral1 A T 11: 78,075,406 D315E probably benign Het
Fam129a A T 1: 151,715,673 Y522F possibly damaging Het
Fbln2 G T 6: 91,263,383 E724* probably null Het
Fyco1 A G 9: 123,827,182 probably benign Het
Fzd3 T A 14: 65,235,724 E198D probably damaging Het
Fzd9 T C 5: 135,250,554 N159S probably damaging Het
Galnt6 T A 15: 100,703,378 Q340L probably benign Het
Gm20939 C T 17: 94,877,094 A390V probably damaging Het
Gm5435 T G 12: 82,495,690 noncoding transcript Het
Gm9949 A C 18: 62,184,018 probably benign Het
Gprc5b G A 7: 118,983,761 T295I probably benign Het
Gria2 G T 3: 80,691,397 Q777K probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Haao T C 17: 83,834,889 T174A probably benign Het
Hes6 A T 1: 91,413,136 M1K probably null Het
Hook3 G T 8: 26,110,752 Q43K probably benign Het
Klhl35 T C 7: 99,471,695 V390A probably damaging Het
Myh9 G T 15: 77,771,857 T1151K probably damaging Het
Nbn A T 4: 15,981,668 I587F possibly damaging Het
Nek4 A G 14: 30,982,451 D696G probably damaging Het
Nlrp2 T C 7: 5,308,725 D52G probably damaging Het
Oit3 G T 10: 59,428,074 R413S probably damaging Het
Olfr1298 T A 2: 111,645,682 H105L probably damaging Het
Olfr786 A G 10: 129,437,711 M300V probably benign Het
Otof T C 5: 30,371,005 T1870A probably benign Het
Pdgfd T C 9: 6,293,939 probably null Het
Pitrm1 T C 13: 6,563,470 V526A possibly damaging Het
Pknox1 T C 17: 31,595,282 S194P probably damaging Het
Plekhg5 T C 4: 152,096,809 S8P probably benign Het
Ppp1r13b T C 12: 111,840,982 E157G probably damaging Het
Psmd3 C T 11: 98,694,225 R466W probably damaging Het
Ptgfrn A G 3: 101,060,651 F542S possibly damaging Het
Ptgs1 A T 2: 36,245,202 M393L possibly damaging Het
Qpct T A 17: 79,064,063 S87T probably benign Het
Qtrt1 T A 9: 21,419,311 V269D probably benign Het
Rassf9 C G 10: 102,544,960 R68G probably damaging Het
Rif1 A G 2: 52,073,223 E25G probably damaging Het
Rnf213 T C 11: 119,414,526 F528L probably benign Het
Sgip1 T C 4: 102,966,260 S693P probably benign Het
She A G 3: 89,854,614 D460G probably benign Het
Sipa1l1 G T 12: 82,341,161 V54L probably benign Het
Slc8a3 T A 12: 81,205,007 D640V possibly damaging Het
Smurf1 T A 5: 144,882,513 E601D probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synpo2l A G 14: 20,661,278 S425P probably damaging Het
Tbck T C 3: 132,715,693 V187A possibly damaging Het
Tcf23 A T 5: 30,968,831 H18L probably benign Het
Tcp11l2 A G 10: 84,584,944 S16G probably damaging Het
Tekt2 T A 4: 126,323,407 M233L probably benign Het
Tex14 T C 11: 87,536,808 S29P probably damaging Het
Tjp2 T A 19: 24,132,703 N59I probably damaging Het
Tlr5 G A 1: 182,975,010 M626I probably benign Het
Tnn A T 1: 160,125,415 V685D probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trhr G A 15: 44,197,101 V6I probably benign Het
Trim30c C T 7: 104,382,951 R301Q probably benign Het
Usp51 T C X: 153,007,992 I194T probably benign Het
Vmn2r63 A G 7: 42,904,126 S569P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zcchc14 T C 8: 121,603,979 M882V probably benign Het
Zfhx2 A G 14: 55,065,088 V1813A probably benign Het
Zswim2 C T 2: 83,915,282 G604D possibly damaging Het
Zzef1 C T 11: 72,848,733 Q669* probably null Het
Other mutations in Vps26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0566:Vps26a UTSW 10 62480546 splice site probably benign
R0801:Vps26a UTSW 10 62459078 splice site probably benign
R0856:Vps26a UTSW 10 62468410 missense possibly damaging 0.84
R1785:Vps26a UTSW 10 62468397 missense probably benign 0.01
R1833:Vps26a UTSW 10 62459046 missense probably benign 0.00
R2173:Vps26a UTSW 10 62468392 missense probably damaging 1.00
R4516:Vps26a UTSW 10 62468345 missense probably damaging 1.00
R5339:Vps26a UTSW 10 62458967 missense probably damaging 1.00
R5391:Vps26a UTSW 10 62456747 makesense probably null
R5646:Vps26a UTSW 10 62468298 missense probably damaging 1.00
R6154:Vps26a UTSW 10 62468340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCAGGGGCATGGAAGTCTATT -3'
(R):5'- AGATAATTGCgggctggcaagatg -3'

Sequencing Primer
(F):5'- GCATGGAAGTCTATTCAGCTCAAG -3'
(R):5'- GTGACACATACTCTTTCCAAATAGGT -3'
Posted On2014-04-13