Incidental Mutation 'R1572:Ticrr'
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
MMRRC Submission 039611-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1572 (G1)
Quality Score184
Status Validated
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79681824 bp
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000145735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: V723A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: V723A

low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: V723A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Efr3a T A 15: 65,854,792 probably null Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Elmo3 A G 8: 105,308,301 T408A probably benign Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lct A G 1: 128,294,195 F1536L probably benign Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nrcam T A 12: 44,537,364 probably benign Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Paip1 T C 13: 119,451,784 probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 unclassified probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttgcttgctttctttctttctttc -3'
Posted On2014-04-13