Incidental Mutation 'R1572:Elmo3'
ID170853
Institutional Source Beutler Lab
Gene Symbol Elmo3
Ensembl Gene ENSMUSG00000014791
Gene Nameengulfment and cell motility 3
SynonymsCED-12
MMRRC Submission 039611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R1572 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105305601-105310760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105308301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 408 (T408A)
Ref Sequence ENSEMBL: ENSMUSP00000105000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000070508] [ENSMUST00000109375] [ENSMUST00000209964] [ENSMUST00000210412] [ENSMUST00000210801] [ENSMUST00000211199] [ENSMUST00000212033] [ENSMUST00000212046]
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070508
SMART Domains Protein: ENSMUSP00000063248
Gene: ENSMUSG00000041679

DomainStartEndE-ValueType
LRR 42 67 7.15e-2 SMART
LRR 68 93 1.92e-2 SMART
LRR 94 119 1.23e0 SMART
LRR 120 145 1.56e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093622
Predicted Effect probably benign
Transcript: ENSMUST00000109375
AA Change: T408A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791
AA Change: T408A

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184892
Predicted Effect probably benign
Transcript: ENSMUST00000209964
Predicted Effect probably benign
Transcript: ENSMUST00000210412
Predicted Effect probably benign
Transcript: ENSMUST00000210801
Predicted Effect probably benign
Transcript: ENSMUST00000211199
Predicted Effect probably benign
Transcript: ENSMUST00000212033
AA Change: T391A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212655
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Efr3a T A 15: 65,854,792 probably null Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lct A G 1: 128,294,195 F1536L probably benign Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nrcam T A 12: 44,537,364 probably benign Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Paip1 T C 13: 119,451,784 probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Ticrr T C 7: 79,681,824 V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Elmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Elmo3 APN 8 105308323 missense probably benign 0.22
IGL02580:Elmo3 APN 8 105308494 missense probably damaging 1.00
IGL03126:Elmo3 APN 8 105306381 missense probably damaging 1.00
IGL03349:Elmo3 APN 8 105306388 missense possibly damaging 0.95
R0119:Elmo3 UTSW 8 105309768 missense probably damaging 1.00
R0244:Elmo3 UTSW 8 105309171 missense probably benign 0.03
R1861:Elmo3 UTSW 8 105308581 missense probably damaging 1.00
R2143:Elmo3 UTSW 8 105308673 missense probably damaging 1.00
R2344:Elmo3 UTSW 8 105309161 missense probably damaging 1.00
R2920:Elmo3 UTSW 8 105308059 missense possibly damaging 0.61
R3687:Elmo3 UTSW 8 105308836 critical splice donor site probably null
R3944:Elmo3 UTSW 8 105309220 critical splice donor site probably null
R4992:Elmo3 UTSW 8 105309501 nonsense probably null
R5255:Elmo3 UTSW 8 105307353 missense probably benign 0.08
R5976:Elmo3 UTSW 8 105307647 missense probably damaging 1.00
R6340:Elmo3 UTSW 8 105306747 missense probably damaging 1.00
R6826:Elmo3 UTSW 8 105306746 missense probably damaging 1.00
V8831:Elmo3 UTSW 8 105307061 missense probably benign 0.24
X0060:Elmo3 UTSW 8 105306013 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTCCAGACATGCACCAAGTG -3'
(R):5'- TGTCAAAATCTTCCTGTGTTGCCCG -3'

Sequencing Primer
(F):5'- TGCATACAGTCGGGTCAGTAAC -3'
(R):5'- ATTCAGTAGCTGGATAGCCAC -3'
Posted On2014-04-13