Incidental Mutation 'R1572:Nrcam'
ID170879
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Nameneuronal cell adhesion molecule
SynonymsC030017F07Rik, Bravo, C130076O07Rik
MMRRC Submission 039611-MU
Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1572 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location44328885-44601964 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 44537364 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000217907] [ENSMUST00000218431] [ENSMUST00000218540] [ENSMUST00000219939] [ENSMUST00000220123] [ENSMUST00000220126]
Predicted Effect probably benign
Transcript: ENSMUST00000020939
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110748
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217907
Predicted Effect probably benign
Transcript: ENSMUST00000218431
Predicted Effect probably benign
Transcript: ENSMUST00000218540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219928
Predicted Effect probably benign
Transcript: ENSMUST00000219939
Predicted Effect probably benign
Transcript: ENSMUST00000220123
Predicted Effect probably benign
Transcript: ENSMUST00000220126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220130
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Efr3a T A 15: 65,854,792 probably null Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Elmo3 A G 8: 105,308,301 T408A probably benign Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lct A G 1: 128,294,195 F1536L probably benign Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Paip1 T C 13: 119,451,784 probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Ticrr T C 7: 79,681,824 V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44575884 missense probably benign 0.27
IGL01657:Nrcam APN 12 44559800 missense probably damaging 1.00
IGL02434:Nrcam APN 12 44590243 splice site probably benign
IGL02455:Nrcam APN 12 44570530 missense probably damaging 1.00
IGL02712:Nrcam APN 12 44573827 missense probably damaging 1.00
IGL02834:Nrcam APN 12 44541075 critical splice donor site probably null
IGL03022:Nrcam APN 12 44598442 missense probably damaging 1.00
IGL03174:Nrcam APN 12 44576006 splice site probably benign
IGL03389:Nrcam APN 12 44549906 missense probably benign 0.00
IGL03397:Nrcam APN 12 44559757 missense probably damaging 1.00
I2288:Nrcam UTSW 12 44564315 missense probably benign 0.06
I2289:Nrcam UTSW 12 44564315 missense probably benign 0.06
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44584845 missense probably benign 0.00
R0463:Nrcam UTSW 12 44551341 missense probably damaging 1.00
R0590:Nrcam UTSW 12 44564032 missense probably damaging 1.00
R0674:Nrcam UTSW 12 44564322 missense probably benign 0.17
R0930:Nrcam UTSW 12 44549884 missense probably benign
R1241:Nrcam UTSW 12 44590164 missense probably damaging 1.00
R1279:Nrcam UTSW 12 44544877 unclassified probably null
R1523:Nrcam UTSW 12 44572249 missense probably damaging 1.00
R1629:Nrcam UTSW 12 44563986 missense probably benign 0.00
R1651:Nrcam UTSW 12 44576679 missense probably damaging 0.97
R1729:Nrcam UTSW 12 44573850 missense probably benign
R1739:Nrcam UTSW 12 44571675 missense probably damaging 1.00
R1803:Nrcam UTSW 12 44572208 missense probably benign
R1884:Nrcam UTSW 12 44544755 missense probably damaging 1.00
R1974:Nrcam UTSW 12 44563993 missense probably benign 0.05
R1992:Nrcam UTSW 12 44540970 missense probably damaging 1.00
R2102:Nrcam UTSW 12 44576688 missense probably benign 0.00
R2106:Nrcam UTSW 12 44570290 missense probably benign 0.12
R3854:Nrcam UTSW 12 44575884 missense probably benign 0.27
R4005:Nrcam UTSW 12 44532646 missense probably benign
R4088:Nrcam UTSW 12 44572202 missense possibly damaging 0.93
R4115:Nrcam UTSW 12 44566326 missense possibly damaging 0.87
R4428:Nrcam UTSW 12 44576775 missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44559730 missense probably damaging 1.00
R4580:Nrcam UTSW 12 44562540 critical splice donor site probably null
R4601:Nrcam UTSW 12 44591056 missense probably damaging 1.00
R4688:Nrcam UTSW 12 44547237 missense probably benign
R4825:Nrcam UTSW 12 44575986 nonsense probably null
R4838:Nrcam UTSW 12 44574019 missense probably damaging 1.00
R4950:Nrcam UTSW 12 44598490 missense probably damaging 1.00
R4960:Nrcam UTSW 12 44566299 missense probably benign 0.01
R5081:Nrcam UTSW 12 44570353 missense probably benign 0.00
R5297:Nrcam UTSW 12 44544784 missense probably damaging 1.00
R5504:Nrcam UTSW 12 44564132 critical splice donor site probably null
R5593:Nrcam UTSW 12 44559700 missense probably damaging 1.00
R5654:Nrcam UTSW 12 44564058 missense probably benign
R5691:Nrcam UTSW 12 44564256 missense probably damaging 1.00
R5890:Nrcam UTSW 12 44576771 missense probably benign
R5937:Nrcam UTSW 12 44572291 missense probably benign 0.00
R5980:Nrcam UTSW 12 44571633 missense probably damaging 1.00
R6132:Nrcam UTSW 12 44570224 missense probably damaging 1.00
R6213:Nrcam UTSW 12 44562432 missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44572300 missense probably benign
R6617:Nrcam UTSW 12 44540963 missense probably damaging 1.00
R6666:Nrcam UTSW 12 44571555 missense probably damaging 1.00
U24488:Nrcam UTSW 12 44537259 missense probably damaging 1.00
X0057:Nrcam UTSW 12 44551416 missense probably benign
X0066:Nrcam UTSW 12 44550029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCATTGCTTGACCCGAAAGAAG -3'
(R):5'- TGCTACTCGCAGTGAGAGCTATCC -3'

Sequencing Primer
(F):5'- CCGAAAGAAGCATGGATTTCTC -3'
(R):5'- TATCCGACTAAGAGAAAGCGTTC -3'
Posted On2014-04-13