Incidental Mutation 'R1572:Paip1'
ID170895
Institutional Source Beutler Lab
Gene Symbol Paip1
Ensembl Gene ENSMUSG00000025451
Gene Namepolyadenylate binding protein-interacting protein 1
Synonyms
MMRRC Submission 039611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R1572 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location119428601-119458218 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 119451784 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627] [ENSMUST00000174533]
Predicted Effect probably benign
Transcript: ENSMUST00000026520
SMART Domains Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 44 61 8.9e-8 PFAM
MIF4G 80 297 2.62e-46 SMART
low complexity region 373 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109203
SMART Domains Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 11 28 3.7e-7 PFAM
MIF4G 47 264 2.62e-46 SMART
low complexity region 340 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126957
SMART Domains Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 3.3e-7 PFAM
MIF4G 164 381 2.62e-46 SMART
low complexity region 457 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132304
SMART Domains Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 6.8e-5 PFAM
Pfam:MIF4G 164 267 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173339
Predicted Effect probably benign
Transcript: ENSMUST00000173627
SMART Domains Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 44 61 3.6e-7 PFAM
MIF4G 80 297 2.62e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174533
SMART Domains Protein: ENSMUSP00000134365
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:MIF4G 49 106 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174691
SMART Domains Protein: ENSMUSP00000134502
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 36 53 2.4e-7 PFAM
Pfam:MIF4G 72 207 1.6e-27 PFAM
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Efr3a T A 15: 65,854,792 probably null Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Elmo3 A G 8: 105,308,301 T408A probably benign Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lct A G 1: 128,294,195 F1536L probably benign Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nrcam T A 12: 44,537,364 probably benign Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Ticrr T C 7: 79,681,824 V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Paip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Paip1 APN 13 119438071 missense probably damaging 1.00
IGL02873:Paip1 APN 13 119445812 missense possibly damaging 0.95
R0517:Paip1 UTSW 13 119447790 missense probably damaging 1.00
R0791:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R0792:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R1419:Paip1 UTSW 13 119457017 missense probably damaging 0.99
R1935:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R1936:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R2072:Paip1 UTSW 13 119430262 missense possibly damaging 0.88
R3827:Paip1 UTSW 13 119430232 start codon destroyed probably null 0.47
R4082:Paip1 UTSW 13 119457004 missense probably damaging 1.00
R4092:Paip1 UTSW 13 119449913 missense probably benign 0.02
R4854:Paip1 UTSW 13 119449889 splice site probably benign
R5012:Paip1 UTSW 13 119447802 missense probably benign
R5103:Paip1 UTSW 13 119437979 missense possibly damaging 0.95
R5425:Paip1 UTSW 13 119430166 missense possibly damaging 0.60
R5592:Paip1 UTSW 13 119450798 missense probably damaging 1.00
R5851:Paip1 UTSW 13 119440765 missense possibly damaging 0.94
R5929:Paip1 UTSW 13 119445790 missense probably damaging 1.00
R5976:Paip1 UTSW 13 119456997 missense probably damaging 1.00
R6021:Paip1 UTSW 13 119457135 frame shift probably null
R6326:Paip1 UTSW 13 119430217 missense probably benign 0.00
R6964:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TAAGTCACAGTTCAGCCAGGGAGG -3'
(R):5'- ACAGTTCCACTTGTCACAACTACTGC -3'

Sequencing Primer
(F):5'- CTAGGACTCAAGAGTGTGAGATGAC -3'
(R):5'- CAGTCAACTAGAATCATCTTTGCC -3'
Posted On2014-04-13