Incidental Mutation 'R1573:Stk39'
ID170930
Institutional Source Beutler Lab
Gene Symbol Stk39
Ensembl Gene ENSMUSG00000027030
Gene Nameserine/threonine kinase 39
SynonymsDCHT, Rnl5, RF005, SPAK
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R1573 (G1)
Quality Score213
Status Validated
Chromosome2
Chromosomal Location68210445-68472268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68390949 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000099776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102715]
Predicted Effect probably damaging
Transcript: ENSMUST00000102715
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 14 65 N/A INTRINSIC
S_TKc 75 349 4.44e-80 SMART
Pfam:OSR1_C 463 494 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149581
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Stk39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Stk39 APN 2 68314564 missense possibly damaging 0.81
IGL00966:Stk39 APN 2 68211958 missense probably benign 0.01
IGL01936:Stk39 APN 2 68314564 missense probably benign 0.21
IGL02301:Stk39 APN 2 68211962 missense probably damaging 1.00
IGL02940:Stk39 APN 2 68220899 splice site probably null
R0570:Stk39 UTSW 2 68410048 missense probably damaging 1.00
R0609:Stk39 UTSW 2 68366167 missense probably damaging 1.00
R0670:Stk39 UTSW 2 68366182 missense possibly damaging 0.93
R0980:Stk39 UTSW 2 68392171 missense probably damaging 1.00
R1024:Stk39 UTSW 2 68410046 missense probably damaging 1.00
R1713:Stk39 UTSW 2 68307116 splice site probably benign
R2223:Stk39 UTSW 2 68314579 missense probably damaging 0.96
R3700:Stk39 UTSW 2 68392118 missense probably damaging 1.00
R4207:Stk39 UTSW 2 68220920 missense probably benign 0.42
R4298:Stk39 UTSW 2 68390940 missense probably damaging 1.00
R4726:Stk39 UTSW 2 68263303 missense probably damaging 1.00
R4975:Stk39 UTSW 2 68220992 intron probably benign
R5057:Stk39 UTSW 2 68220948 missense probably damaging 0.99
R5384:Stk39 UTSW 2 68410039 missense probably damaging 1.00
R5921:Stk39 UTSW 2 68366105 missense probably damaging 0.97
R6125:Stk39 UTSW 2 68392124 missense probably damaging 1.00
R6251:Stk39 UTSW 2 68307039 critical splice donor site probably null
R6332:Stk39 UTSW 2 68410043 missense possibly damaging 0.93
R6375:Stk39 UTSW 2 68392238 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGCAGATCGAGCCAAGATTCACC -3'
(R):5'- ACTGTGCCTCGGGAGCAAAATG -3'

Sequencing Primer
(F):5'- AGTCCCAGGCATTCCGTAAG -3'
(R):5'- AGCGTCATAGCTAACCTGTG -3'
Posted On2014-04-13