Incidental Mutation 'R1573:Car9'
ID170943
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Namecarbonic anhydrase 9
SynonymsCAIX, MN/CA9
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1573 (G1)
Quality Score222
Status Validated
Chromosome4
Chromosomal Location43506966-43513729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43512941 splice site probably benign
IGL01893:Car9 APN 4 43510252 missense probably damaging 1.00
IGL02064:Car9 APN 4 43507363 missense probably benign
R0122:Car9 UTSW 4 43512206 missense probably benign 0.05
R0314:Car9 UTSW 4 43509212 critical splice donor site probably null
R0497:Car9 UTSW 4 43511881 missense probably damaging 1.00
R1018:Car9 UTSW 4 43512439 critical splice donor site probably null
R1132:Car9 UTSW 4 43512439 critical splice donor site probably null
R1218:Car9 UTSW 4 43512439 critical splice donor site probably null
R1219:Car9 UTSW 4 43512439 critical splice donor site probably null
R1222:Car9 UTSW 4 43512439 critical splice donor site probably null
R1350:Car9 UTSW 4 43512439 critical splice donor site probably null
R1351:Car9 UTSW 4 43512439 critical splice donor site probably null
R1352:Car9 UTSW 4 43512439 critical splice donor site probably null
R1353:Car9 UTSW 4 43512439 critical splice donor site probably null
R1389:Car9 UTSW 4 43512439 critical splice donor site probably null
R1417:Car9 UTSW 4 43512439 critical splice donor site probably null
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1470:Car9 UTSW 4 43510222 missense probably damaging 1.00
R1818:Car9 UTSW 4 43512439 critical splice donor site probably null
R1819:Car9 UTSW 4 43512439 critical splice donor site probably null
R4033:Car9 UTSW 4 43508624 missense possibly damaging 0.52
R4597:Car9 UTSW 4 43509138 missense probably damaging 1.00
R4609:Car9 UTSW 4 43507267 missense possibly damaging 0.81
R4719:Car9 UTSW 4 43508616 nonsense probably null
R5402:Car9 UTSW 4 43510213 missense probably damaging 1.00
R5624:Car9 UTSW 4 43509146 missense probably benign 0.03
R6471:Car9 UTSW 4 43511938 missense probably damaging 1.00
R6850:Car9 UTSW 4 43507321 missense probably damaging 0.96
R7318:Car9 UTSW 4 43513089 missense probably damaging 0.99
X0067:Car9 UTSW 4 43507198 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On2014-04-13