Incidental Mutation 'R1573:Saa2'
ID170967
Institutional Source Beutler Lab
Gene Symbol Saa2
Ensembl Gene ENSMUSG00000057465
Gene Nameserum amyloid A 2
SynonymsSaa-2
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1573 (G1)
Quality Score179
Status Validated
Chromosome7
Chromosomal Location46751790-46754313 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 46752292 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000147751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075982] [ENSMUST00000210272] [ENSMUST00000210769]
Predicted Effect probably null
Transcript: ENSMUST00000075982
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075365
Gene: ENSMUSG00000057465
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SAA 21 122 2.29e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210272
Predicted Effect probably null
Transcript: ENSMUST00000210769
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211766
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: The CE/J strain produces a mutant form of Saa2 and is not susceptible to amyloidosis, as are mice of most other inbred strains. M. caroli, M. spretus and M.m. Czech produce variant Saa2 isoforms and M.m. Czech is also reistant to amyloidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Saa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Saa2 APN 7 46753472 missense probably benign
R0453:Saa2 UTSW 7 46753478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACACATGGGAAATGCTTCCTAC -3'
(R):5'- TTCCAGCAAGCAGAGCAGTGAG -3'

Sequencing Primer
(F):5'- CATGCCTTCTTAGACAGAGGTAG -3'
(R):5'- GAGCAGTGAGTCCAACCC -3'
Posted On2014-04-13