Incidental Mutation 'R1573:Ccar1'
ID170973
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Namecell division cycle and apoptosis regulator 1
Synonyms9430036H15Rik, Carp1, 2610511G16Rik
MMRRC Submission 039612-MU
Accession Numbers

Genbank: NM_026201.3; Ensembl: ENSMUST00000020268

Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R1573 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62743928-62792286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62750655 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 920 (D920E)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000219527]
Predicted Effect unknown
Transcript: ENSMUST00000020268
AA Change: D920E
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: D920E

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218786
Predicted Effect unknown
Transcript: ENSMUST00000219527
AA Change: D920E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220236
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62753234 missense unknown
IGL01291:Ccar1 APN 10 62756649 missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62776874 unclassified probably null
IGL01777:Ccar1 APN 10 62780577 missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62790935 missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62764333 missense probably benign 0.20
Lonk UTSW 10 62764533 missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62783886 missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62756649 missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62780457 missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62783882 critical splice donor site probably null
R1585:Ccar1 UTSW 10 62751001 missense unknown
R1633:Ccar1 UTSW 10 62751014 missense unknown
R1840:Ccar1 UTSW 10 62763510 missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62764517 missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62776658 missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62776694 missense probably benign 0.03
R2041:Ccar1 UTSW 10 62766048 missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62745287 missense unknown
R2327:Ccar1 UTSW 10 62764382 missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62776759 missense probably benign 0.08
R3040:Ccar1 UTSW 10 62756494 missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62747417 nonsense probably null
R4829:Ccar1 UTSW 10 62745335 missense unknown
R4887:Ccar1 UTSW 10 62753218 missense unknown
R4888:Ccar1 UTSW 10 62753218 missense unknown
R5000:Ccar1 UTSW 10 62751005 missense unknown
R5207:Ccar1 UTSW 10 62753281 missense unknown
R5214:Ccar1 UTSW 10 62770961 missense probably damaging 1.00
R5644:Ccar1 UTSW 10 62771978 missense probably benign 0.16
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6063:Ccar1 UTSW 10 62776717 missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62764533 missense probably damaging 1.00
R6370:Ccar1 UTSW 10 62764529 missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62764430 missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62746936 missense unknown
V8831:Ccar1 UTSW 10 62747406 missense unknown
X0017:Ccar1 UTSW 10 62765340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGGGTAGCAATTTCTGACACTG -3'
(R):5'- TGCGAAAGATAAGGTGGGTTTTCTTCC -3'

Sequencing Primer
(F):5'- aactgtctagccatgactgag -3'
(R):5'- CTAGAAAATCACGATTTCCCTATCTC -3'
Posted On2014-04-13