Incidental Mutation 'R1573:Cacna1i'
ID170995
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Namecalcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1573 (G1)
Quality Score139
Status Validated
Chromosome15
Chromosomal Location80287238-80398279 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 80393668 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
Predicted Effect probably null
Transcript: ENSMUST00000160175
SMART Domains Protein: ENSMUSP00000123881
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160424
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161863
SMART Domains Protein: ENSMUSP00000124367
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162025
SMART Domains Protein: ENSMUSP00000125530
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 87 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162155
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162913
SMART Domains Protein: ENSMUSP00000125617
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Meta Mutation Damage Score 0.6128 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80382019 missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80355645 missense probably benign
IGL01338:Cacna1i APN 15 80348380 missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80387759 splice site probably benign
IGL01669:Cacna1i APN 15 80391757 missense probably benign
IGL01807:Cacna1i APN 15 80374147 missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80391732 missense probably benign 0.09
IGL01973:Cacna1i APN 15 80382033 missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80372951 missense probably benign 0.06
IGL02519:Cacna1i APN 15 80361874 nonsense probably null
IGL02648:Cacna1i APN 15 80298638 missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80362239 missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80355716 missense probably benign 0.30
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80356211 missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80372462 missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80368830 splice site probably benign
R0637:Cacna1i UTSW 15 80372654 missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80381080 missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80358949 missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80379054 missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80391774 splice site probably null
R1563:Cacna1i UTSW 15 80321188 missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80389855 splice site probably benign
R1654:Cacna1i UTSW 15 80389210 missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80371529 missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80389122 missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80376789 missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80358931 missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80391642 missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80375264 missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80395044 missense probably benign
R2162:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80374767 missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80381071 splice site probably benign
R3702:Cacna1i UTSW 15 80381071 splice site probably benign
R3832:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80388479 missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80369662 missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80368671 missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80348449 missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80390840 missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80371529 missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80371499 missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80395078 missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80389132 missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80321226 missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80336682 missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80355758 missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80378247 missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80321259 missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80374809 missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80374801 missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80361962 missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80362139 missense probably benign 0.03
X0058:Cacna1i UTSW 15 80379102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCCATTCCCTGAGGAAGAAG -3'
(R):5'- ACCTCTCCTCTCAAGTCTCAGAAGC -3'

Sequencing Primer
(F):5'- AGTCTGGCCTGCTGAGC -3'
(R):5'- AGTTGACACTCGGTGACCTC -3'
Posted On2014-04-13