Incidental Mutation 'R1573:Mlc1'
ID170997
Institutional Source Beutler Lab
Gene Symbol Mlc1
Ensembl Gene ENSMUSG00000035805
Gene Namemegalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
SynonymsWKL1, Kiaa0027-hp
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1573 (G1)
Quality Score142
Status Validated
Chromosome15
Chromosomal Location88955884-88979007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88958147 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 337 (C337G)
Ref Sequence ENSEMBL: ENSMUSP00000104993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042594] [ENSMUST00000109368] [ENSMUST00000109371] [ENSMUST00000177180]
Predicted Effect probably damaging
Transcript: ENSMUST00000042594
AA Change: C331G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047667
Gene: ENSMUSG00000035805
AA Change: C331G

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 266 288 N/A INTRINSIC
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109368
AA Change: C337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104993
Gene: ENSMUSG00000035805
AA Change: C337G

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109371
SMART Domains Protein: ENSMUSP00000104996
Gene: ENSMUSG00000022388

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
Pfam:TTL 324 621 3.9e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177180
SMART Domains Protein: ENSMUSP00000135381
Gene: ENSMUSG00000022388

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177254
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene product is unknown; however, homology to other proteins suggests that it may be an integral membrane transporter. Mutations in this gene have been associated with megalencephalic leukoencephalopathy with subcortical cysts, an autosomal recessive neurological disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit myelin vacuolization that progresses with age, and show alterations in glial cell and oligodendrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Mlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Mlc1 APN 15 88974718 splice site probably benign
IGL03251:Mlc1 APN 15 88974731 missense possibly damaging 0.88
R0710:Mlc1 UTSW 15 88977864 missense possibly damaging 0.88
R1037:Mlc1 UTSW 15 88965461 missense probably damaging 1.00
R1994:Mlc1 UTSW 15 88974579 missense possibly damaging 0.50
R2121:Mlc1 UTSW 15 88963431 missense probably benign 0.22
R2302:Mlc1 UTSW 15 88965437 missense possibly damaging 0.63
R3110:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3112:Mlc1 UTSW 15 88965996 missense probably benign 0.00
R3117:Mlc1 UTSW 15 88976528 missense probably damaging 1.00
R4027:Mlc1 UTSW 15 88966494 missense probably benign 0.29
R4450:Mlc1 UTSW 15 88963490 missense probably benign 0.19
R4576:Mlc1 UTSW 15 88974537 missense probably damaging 1.00
R4697:Mlc1 UTSW 15 88974777 missense probably damaging 1.00
R4728:Mlc1 UTSW 15 88978031 intron probably null
R4910:Mlc1 UTSW 15 88958212 missense possibly damaging 0.94
R5618:Mlc1 UTSW 15 88974566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGAGAGTGGAGCTGAAAACCC -3'
(R):5'- ACCGAAGCATAAGAAGCCTGTGTG -3'

Sequencing Primer
(F):5'- GAGCTGAAAACCCTGTAGCC -3'
(R):5'- CCTGTTGAAACCTTAGGCGAG -3'
Posted On2014-04-13