Incidental Mutation 'R1573:Alk'
ID171002
Institutional Source Beutler Lab
Gene Symbol Alk
Ensembl Gene ENSMUSG00000055471
Gene Nameanaplastic lymphoma kinase
SynonymsCD246, Tcrz
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1573 (G1)
Quality Score90
Status Validated
Chromosome17
Chromosomal Location71869442-72603709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72603118 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 198 (K198E)
Ref Sequence ENSEMBL: ENSMUSP00000083840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086639
AA Change: K198E

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: K198E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:MAM 270 431 5.6e-10 PFAM
LDLa 441 477 5.59e-3 SMART
Pfam:MAM 484 640 5.6e-22 PFAM
Pfam:Gly_rich 730 996 8.6e-19 PFAM
low complexity region 1037 1057 N/A INTRINSIC
TyrKc 1120 1387 2.76e-140 SMART
low complexity region 1440 1480 N/A INTRINSIC
low complexity region 1551 1570 N/A INTRINSIC
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Lgi1 T A 19: 38,284,181 H133Q probably benign Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Alk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Alk APN 17 71895748 missense probably damaging 1.00
IGL00796:Alk APN 17 71905142 missense possibly damaging 0.88
IGL01096:Alk APN 17 71921896 missense possibly damaging 0.87
IGL01367:Alk APN 17 71900786 missense probably damaging 1.00
IGL01402:Alk APN 17 71874178 missense probably damaging 1.00
IGL01652:Alk APN 17 72603531 missense probably damaging 1.00
IGL01717:Alk APN 17 72603382 missense probably benign
IGL02301:Alk APN 17 71874176 missense probably damaging 0.99
IGL02403:Alk APN 17 71901393 missense probably damaging 1.00
IGL02452:Alk APN 17 71902625 nonsense probably null
IGL02724:Alk APN 17 71985460 missense probably benign 0.00
IGL02826:Alk APN 17 71869536 missense probably damaging 1.00
IGL02863:Alk APN 17 71897835 missense probably damaging 1.00
IGL02994:Alk APN 17 71949820 missense probably benign 0.00
IGL03329:Alk APN 17 71899164 splice site probably benign
R0157:Alk UTSW 17 71949845 missense probably benign 0.00
R0211:Alk UTSW 17 72603516 missense probably damaging 1.00
R0257:Alk UTSW 17 72603495 missense probably damaging 1.00
R0269:Alk UTSW 17 72603583 missense probably damaging 1.00
R0395:Alk UTSW 17 72603531 missense probably damaging 0.99
R0414:Alk UTSW 17 71899286 splice site probably benign
R0466:Alk UTSW 17 71905157 missense possibly damaging 0.51
R0526:Alk UTSW 17 71869753 missense probably damaging 1.00
R0617:Alk UTSW 17 72603583 missense probably damaging 1.00
R0781:Alk UTSW 17 71984745 splice site probably benign
R0830:Alk UTSW 17 72603200 missense probably benign 0.01
R0835:Alk UTSW 17 71869842 missense probably damaging 0.97
R0894:Alk UTSW 17 71895935 missense probably damaging 1.00
R1110:Alk UTSW 17 71984745 splice site probably benign
R1170:Alk UTSW 17 71900734 missense probably damaging 1.00
R1667:Alk UTSW 17 71911567 missense probably damaging 1.00
R1748:Alk UTSW 17 72603421 missense probably benign 0.19
R1767:Alk UTSW 17 71900698 missense possibly damaging 0.73
R1836:Alk UTSW 17 71891037 missense probably damaging 1.00
R1861:Alk UTSW 17 71874938 splice site probably benign
R2905:Alk UTSW 17 71985494 missense probably benign 0.40
R2925:Alk UTSW 17 72603207 missense probably benign
R3727:Alk UTSW 17 71901400 splice site probably benign
R3747:Alk UTSW 17 71911565 missense probably damaging 0.99
R3790:Alk UTSW 17 72603432 missense possibly damaging 0.95
R3909:Alk UTSW 17 71897911 missense probably benign 0.00
R3934:Alk UTSW 17 72205954 missense probably damaging 1.00
R3936:Alk UTSW 17 72205954 missense probably damaging 1.00
R3972:Alk UTSW 17 71985447 missense probably benign 0.16
R4433:Alk UTSW 17 71899241 nonsense probably null
R4716:Alk UTSW 17 72205942 missense probably damaging 1.00
R4903:Alk UTSW 17 71869563 missense probably damaging 1.00
R4921:Alk UTSW 17 71904315 missense probably benign 0.30
R4954:Alk UTSW 17 71902692 nonsense probably null
R5377:Alk UTSW 17 71895739 missense probably damaging 1.00
R5386:Alk UTSW 17 71875012 missense probably damaging 1.00
R5551:Alk UTSW 17 71875033 missense possibly damaging 0.53
R5704:Alk UTSW 17 72603120 missense probably damaging 1.00
R5877:Alk UTSW 17 71967526 missense probably damaging 1.00
R5888:Alk UTSW 17 71874943 missense probably damaging 1.00
R6013:Alk UTSW 17 71900737 missense probably benign 0.15
R6044:Alk UTSW 17 71992100 missense probably benign 0.00
R6058:Alk UTSW 17 71869747 missense probably benign 0.01
R6126:Alk UTSW 17 71875042 missense possibly damaging 0.82
R6286:Alk UTSW 17 71880847 missense probably damaging 0.98
R6744:Alk UTSW 17 72603082 missense probably benign 0.35
R6989:Alk UTSW 17 71897952 missense probably benign 0.00
Z1088:Alk UTSW 17 72205807 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATCGTGTGTAAGTCAGTGGAAGGC -3'
(R):5'- TCTGGCAGTGGACTTCGTTGTACC -3'

Sequencing Primer
(F):5'- CTCCCAACTTGGTTGCTAGAGAG -3'
(R):5'- AGATGGAGCCAGTTCTCCTAGTC -3'
Posted On2014-04-13