Incidental Mutation 'R1573:Lgi1'
ID171008
Institutional Source Beutler Lab
Gene Symbol Lgi1
Ensembl Gene ENSMUSG00000067242
Gene Nameleucine-rich repeat LGI family, member 1
Synonyms
MMRRC Submission 039612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R1573 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38264536-38312214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38284181 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 133 (H133Q)
Ref Sequence ENSEMBL: ENSMUSP00000143128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087252] [ENSMUST00000196090] [ENSMUST00000197123] [ENSMUST00000198045] [ENSMUST00000198518] [ENSMUST00000199812]
Predicted Effect probably benign
Transcript: ENSMUST00000087252
SMART Domains Protein: ENSMUSP00000084507
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 225 266 3.8e-9 PFAM
Pfam:EPTP 271 312 6.5e-12 PFAM
Pfam:EPTP 317 363 7.2e-16 PFAM
Pfam:EPTP 366 414 1.4e-7 PFAM
Pfam:EPTP 419 461 1.6e-12 PFAM
Pfam:EPTP 464 505 7.7e-11 PFAM
Pfam:EPTP 510 550 3.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130039
SMART Domains Protein: ENSMUSP00000117936
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
LRR 51 74 2.61e2 SMART
LRR_TYP 75 98 5.14e-3 SMART
LRR_TYP 99 122 2.27e-4 SMART
LRRCT 131 180 4.63e-6 SMART
Pfam:EPTP 182 218 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196090
SMART Domains Protein: ENSMUSP00000143538
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 3.3e-4 SMART
LRRCT 125 174 2.3e-8 SMART
Pfam:EPTP 177 218 3.1e-6 PFAM
Pfam:EPTP 223 264 5.3e-9 PFAM
Pfam:EPTP 269 315 5.8e-13 PFAM
Pfam:EPTP 318 366 1.1e-4 PFAM
Pfam:EPTP 371 413 1.3e-9 PFAM
Pfam:EPTP 416 457 6.2e-8 PFAM
Pfam:EPTP 462 502 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197123
SMART Domains Protein: ENSMUSP00000142953
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198045
AA Change: H133Q

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143292
Gene: ENSMUSG00000067242
AA Change: H133Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
LRR 90 113 1.1e0 SMART
LRR_TYP 114 137 2.1e-5 SMART
LRR_TYP 138 161 9.2e-7 SMART
LRRCT 173 222 2.3e-8 SMART
Pfam:EPTP 224 267 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198518
AA Change: H133Q

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143128
Gene: ENSMUSG00000067242
AA Change: H133Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 224 267 8.3e-15 PFAM
Pfam:EPTP 270 313 9.4e-16 PFAM
Pfam:EPTP 316 364 3.3e-18 PFAM
Pfam:EPTP 365 415 5.2e-8 PFAM
Pfam:EPTP 418 462 1e-16 PFAM
Pfam:EPTP 463 506 1.9e-15 PFAM
Pfam:EPTP 509 550 2.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199812
AA Change: H109Q

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143502
Gene: ENSMUSG00000067242
AA Change: H109Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 2.2e-5 SMART
LRR_TYP 114 137 9.4e-7 SMART
LRRCT 149 198 2.3e-8 SMART
Pfam:EPTP 201 242 3.2e-6 PFAM
Pfam:EPTP 247 288 5.6e-9 PFAM
Pfam:EPTP 293 339 6.1e-13 PFAM
Pfam:EPTP 342 390 1.2e-4 PFAM
Pfam:EPTP 395 437 1.4e-9 PFAM
Pfam:EPTP 440 481 6.6e-8 PFAM
Pfam:EPTP 486 526 2.9e-10 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the secreted leucine-rich repeat (LRR) superfamily and shares homology with members of the SLIT protein family. The encoded protein may regulate the activity of voltage-gated potassium channels and may be involved in neuronal growth regulation and cell survival. This gene is rearranged as a result of translocations in glioblastoma cell lines, and it is frequently down-regulated or rearranged in malignant gliomas. Mutations in this gene result in autosomal dominant lateral temporal epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, seizures, and death by the third week of life. Mice heterozygous for this allele exhibit increased suseptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,113,618 probably benign Het
Add1 C G 5: 34,601,396 A18G possibly damaging Het
Alk T C 17: 72,603,118 K198E possibly damaging Het
Angptl1 T A 1: 156,857,170 L303Q possibly damaging Het
Aox2 A T 1: 58,309,027 I635L probably benign Het
Atp8a2 G T 14: 59,860,206 T791K probably benign Het
Auts2 T C 5: 131,440,487 K664R probably damaging Het
Birc6 T A 17: 74,660,690 probably benign Het
Cacna1i C A 15: 80,393,668 probably null Het
Cacna2d1 T C 5: 16,370,627 F1077L probably damaging Het
Camkk1 C T 11: 73,027,481 R52C probably damaging Het
Camkmt T A 17: 85,096,530 V60E probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cbr2 A T 11: 120,731,965 L3Q possibly damaging Het
Ccar1 A T 10: 62,750,655 D920E unknown Het
Cdc20b A G 13: 113,055,944 N57S probably benign Het
Cep83 G A 10: 94,788,663 E601K probably damaging Het
Cldn10 A T 14: 118,873,668 I176L probably benign Het
Cpeb2 T C 5: 43,283,930 probably benign Het
Crb1 A G 1: 139,337,606 S25P probably damaging Het
Cyp3a59 A T 5: 146,102,874 Y319F probably damaging Het
Dst C T 1: 34,201,231 S1561F probably damaging Het
Dxo C T 17: 34,838,294 R221C probably damaging Het
Epc2 A G 2: 49,549,972 T801A possibly damaging Het
Fam71a G A 1: 191,164,485 probably benign Het
Fndc3a C A 14: 72,568,944 C373F probably damaging Het
Frmpd1 T C 4: 45,283,932 S918P probably benign Het
Fuca2 A G 10: 13,505,843 T84A possibly damaging Het
Gmeb1 A T 4: 132,251,740 N21K probably benign Het
Htt T C 5: 34,864,374 probably benign Het
Igsf1 T C X: 49,791,986 R251G possibly damaging Het
Itih4 A T 14: 30,897,547 H720L probably benign Het
Kank4 A T 4: 98,774,836 L705* probably null Het
Krt34 A T 11: 100,041,028 S122T probably benign Het
L1td1 A G 4: 98,737,280 T571A probably benign Het
Lag3 T C 6: 124,909,247 T248A possibly damaging Het
Map1a A T 2: 121,304,126 T1808S probably benign Het
Mcm9 T C 10: 53,548,656 T613A probably damaging Het
Meaf6 A G 4: 125,090,138 I111V probably benign Het
Mki67 G A 7: 135,695,116 P2730S possibly damaging Het
Mlc1 A C 15: 88,958,147 C337G probably damaging Het
Mrc2 T A 11: 105,336,656 Y572N probably damaging Het
Mterf3 T C 13: 66,922,903 N172S possibly damaging Het
Olfr1220 T A 2: 89,097,720 D69V probably damaging Het
Olfr1270 A T 2: 90,148,724 probably benign Het
Olfr402 T A 11: 74,155,370 M72K probably benign Het
Olfr804 T C 10: 129,705,618 S247P probably damaging Het
Olfr987 A T 2: 85,331,343 L185H probably damaging Het
Padi4 T G 4: 140,757,570 T327P possibly damaging Het
Pga5 T A 19: 10,673,837 I151F probably benign Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Prokr2 T A 2: 132,373,764 Q259L probably damaging Het
Ptbp2 C A 3: 119,753,105 D43Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgps2 C T 1: 156,832,930 R237Q possibly damaging Het
Rap1gds1 C A 3: 138,965,863 probably null Het
Saa2 T A 7: 46,752,292 M1K probably null Het
Samd9l T C 6: 3,375,426 I612V probably damaging Het
Scn10a C T 9: 119,613,626 V1518I probably benign Het
Serpina6 T C 12: 103,651,753 D267G probably damaging Het
Sh2d4b A G 14: 40,842,372 probably null Het
Sh3bp2 T C 5: 34,560,690 V505A probably benign Het
Smad2 A G 18: 76,262,586 E32G possibly damaging Het
Smn1 T G 13: 100,126,610 D32E probably damaging Het
Spata31d1c T C 13: 65,035,069 S142P possibly damaging Het
Stk39 A T 2: 68,390,949 I210N probably damaging Het
Tcte2 A G 17: 13,717,637 probably benign Het
Tctex1d4 A T 4: 117,127,994 T5S probably benign Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Tenm2 A T 11: 36,047,069 H1592Q probably damaging Het
Tescl A G 7: 24,333,243 V219A probably damaging Het
Tgm6 C T 2: 130,151,740 S633L probably benign Het
Tmcc1 C T 6: 116,133,963 S123N probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ulk2 G A 11: 61,779,755 R992C probably damaging Het
Usmg5 T A 19: 47,086,195 Q9L possibly damaging Het
Vwa5b1 G A 4: 138,604,873 H278Y probably damaging Het
Wwp2 C T 8: 107,548,489 R373W probably damaging Het
Zfp24 A T 18: 24,017,342 D170E possibly damaging Het
Zfp808 T C 13: 62,171,497 I180T possibly damaging Het
Zfp820 T A 17: 21,818,756 Q530H probably benign Het
Zfp975 A T 7: 42,662,083 Y369N probably benign Het
Other mutations in Lgi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Lgi1 APN 19 38284005 missense probably benign 0.24
IGL03112:Lgi1 APN 19 38284030 missense possibly damaging 0.84
R0201:Lgi1 UTSW 19 38301293 missense possibly damaging 0.92
R1795:Lgi1 UTSW 19 38306183 missense probably benign
R2010:Lgi1 UTSW 19 38301235 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3733:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R4643:Lgi1 UTSW 19 38300710 missense probably damaging 1.00
R4678:Lgi1 UTSW 19 38301289 missense probably damaging 1.00
R4814:Lgi1 UTSW 19 38300878 critical splice donor site probably null
R4857:Lgi1 UTSW 19 38306250 missense probably damaging 1.00
R5598:Lgi1 UTSW 19 38306181 missense possibly damaging 0.94
R6180:Lgi1 UTSW 19 38264956 missense probably damaging 1.00
R6196:Lgi1 UTSW 19 38305809 missense probably benign 0.23
R6847:Lgi1 UTSW 19 38301290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCAGACTTACCTGTGTCAGCC -3'
(R):5'- TGCCGTAACCTTAGATGCCAAACTG -3'

Sequencing Primer
(F):5'- CTGGTTCTCTGAGAGACCAAG -3'
(R):5'- ggaccatagctcagtggtag -3'
Posted On2014-04-13