Incidental Mutation 'R1574:D430041D05Rik'
ID171015
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene NameRIKEN cDNA D430041D05 gene
SynonymsG2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1574 (G1)
Quality Score103
Status Not validated
Chromosome2
Chromosomal Location104143073-104411013 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GTGATGATGATGATGATGATG to GTGATGATGATGATGATG at 104221208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]
Predicted Effect probably benign
Transcript: ENSMUST00000089726
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136156
Predicted Effect probably benign
Transcript: ENSMUST00000141159
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156278
Predicted Effect probably benign
Transcript: ENSMUST00000230671
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104201303 missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104258166 nonsense probably null
IGL01669:D430041D05Rik APN 2 104254961 missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104230404 missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104208214 splice site probably benign
IGL02268:D430041D05Rik APN 2 104241155 missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104255006 missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104249345 missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104230286 missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104248266 missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104230305 missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104214259 missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104241163 missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104221211 missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104248374 missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104255044 missense probably benign
R0064:D430041D05Rik UTSW 2 104249157 missense probably damaging 1.00
R0135:D430041D05Rik UTSW 2 104255034 missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104205200 missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104201244 missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104255340 missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 104168164 missense probably damaging 0.99
R0436:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0441:D430041D05Rik UTSW 2 104167947 missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104230306 missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104230428 missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104249345 missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104258329 missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104201303 missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 104155018 missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104208083 missense probably damaging 1.00
R1604:D430041D05Rik UTSW 2 104205142 missense probably damaging 1.00
R1605:D430041D05Rik UTSW 2 104255570 missense possibly damaging 0.46
R1623:D430041D05Rik UTSW 2 104152963 missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104221211 missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 104168101 missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104230455 missense probably benign 0.39
R2080:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2101:D430041D05Rik UTSW 2 104148830 missense probably damaging 1.00
R2240:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104255315 missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104255058 missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104257368 missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104256339 missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104192433 critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104233479 missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104258443 missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104214096 missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104201110 critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104255409 missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104255387 missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104258502 missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104256600 missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104255409 missense probably damaging 0.99
R5368:D430041D05Rik UTSW 2 104248284 missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104248285 missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 104168067 missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104256292 missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 104168203 splice site probably null
R6804:D430041D05Rik UTSW 2 104149026 missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104201259 missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104241155 missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104192538 missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104258353 missense not run
X0024:D430041D05Rik UTSW 2 104192566 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CGAGGCTGTGATGATGTTCCTGAAG -3'
(R):5'- AGCAGCTCGTGTCAACTGATCC -3'

Sequencing Primer
(F):5'- AACCTTTGAAGCCTGGGAGA -3'
(R):5'- acctcttgtgtccttgcc -3'
Posted On2014-04-13