Incidental Mutation 'R1574:Srsf4'
ID171018
Institutional Source Beutler Lab
Gene Symbol Srsf4
Ensembl Gene ENSMUSG00000028911
Gene Nameserine/arginine-rich splicing factor 4
SynonymsMNCb-2616, Sfrs4, SRp75, 5730499P16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R1574 (G1)
Quality Score86
Status Not validated
Chromosome4
Chromosomal Location131873617-131901706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131897695 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 134 (D134E)
Ref Sequence ENSEMBL: ENSMUSP00000061474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053819] [ENSMUST00000134943]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030743
SMART Domains Protein: ENSMUSP00000030743
Gene: ENSMUSG00000028911

DomainStartEndE-ValueType
RRM 14 73 1.09e0 SMART
low complexity region 76 102 N/A INTRINSIC
RRM 110 178 2e-14 SMART
low complexity region 184 277 N/A INTRINSIC
low complexity region 304 328 N/A INTRINSIC
low complexity region 329 408 N/A INTRINSIC
low complexity region 460 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053819
AA Change: D134E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061474
Gene: ENSMUSG00000028911
AA Change: D134E

DomainStartEndE-ValueType
RRM 3 68 4.3e-21 SMART
low complexity region 71 97 N/A INTRINSIC
RRM 105 173 8.4e-17 SMART
low complexity region 179 272 N/A INTRINSIC
low complexity region 299 323 N/A INTRINSIC
low complexity region 324 403 N/A INTRINSIC
low complexity region 455 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000134943
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
D430041D05Rik GTGATGATGATGATGATGATG GTGATGATGATGATGATG 2: 104,221,208 probably benign Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Srsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Srsf4 UTSW 4 131900330 unclassified probably benign
R1135:Srsf4 UTSW 4 131900069 unclassified probably benign
R1209:Srsf4 UTSW 4 131901059 unclassified probably benign
R1276:Srsf4 UTSW 4 131897685 missense probably damaging 1.00
R1561:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1700:Srsf4 UTSW 4 131900560 unclassified probably benign
R2265:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R2269:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R3723:Srsf4 UTSW 4 131900102 unclassified probably benign
R3724:Srsf4 UTSW 4 131900102 unclassified probably benign
R3737:Srsf4 UTSW 4 131900102 unclassified probably benign
R3738:Srsf4 UTSW 4 131900102 unclassified probably benign
R3739:Srsf4 UTSW 4 131900102 unclassified probably benign
R4034:Srsf4 UTSW 4 131900102 unclassified probably benign
R4035:Srsf4 UTSW 4 131900102 unclassified probably benign
R4049:Srsf4 UTSW 4 131900543 unclassified probably benign
R4535:Srsf4 UTSW 4 131873864 missense probably damaging 1.00
R4810:Srsf4 UTSW 4 131900102 unclassified probably benign
R4833:Srsf4 UTSW 4 131900102 unclassified probably benign
R4932:Srsf4 UTSW 4 131891245 missense probably damaging 0.99
R5291:Srsf4 UTSW 4 131886306 critical splice donor site probably benign
R5725:Srsf4 UTSW 4 131900951 unclassified probably benign
R6145:Srsf4 UTSW 4 131900294 unclassified probably benign
R7056:Srsf4 UTSW 4 131900693 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCGTTAGGTCGCCATCTTTATCCAG -3'
(R):5'- TGCCCAACTCATGCTATGTCAACAG -3'

Sequencing Primer
(F):5'- AGCTGCACTTCCCACGTC -3'
(R):5'- ACAGTACCTTGAGTGACTCCG -3'
Posted On2014-04-13