Incidental Mutation 'R1574:Sfi1'
ID171045
Institutional Source Beutler Lab
Gene Symbol Sfi1
Ensembl Gene ENSMUSG00000023764
Gene NameSfi1 homolog, spindle assembly associated (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1574 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location3131850-3193463 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCGC to TC at 3146254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066391] [ENSMUST00000081318] [ENSMUST00000101655] [ENSMUST00000132893] [ENSMUST00000140846] [ENSMUST00000153425]
Predicted Effect probably null
Transcript: ENSMUST00000066391
SMART Domains Protein: ENSMUSP00000067261
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_2 34 236 4.95e-5 PROSPERO
internal_repeat_1 78 336 3.02e-14 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 372 636 3.02e-14 PROSPERO
internal_repeat_2 574 804 4.95e-5 PROSPERO
low complexity region 809 821 N/A INTRINSIC
low complexity region 849 860 N/A INTRINSIC
coiled coil region 1086 1112 N/A INTRINSIC
coiled coil region 1138 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081318
SMART Domains Protein: ENSMUSP00000080066
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 2e-6 PROSPERO
internal_repeat_1 67 288 7.56e-9 PROSPERO
internal_repeat_2 93 401 1.18e-6 PROSPERO
internal_repeat_3 380 607 2e-6 PROSPERO
internal_repeat_1 428 651 7.56e-9 PROSPERO
internal_repeat_2 524 836 1.18e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1118 1144 N/A INTRINSIC
coiled coil region 1170 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101655
SMART Domains Protein: ENSMUSP00000099178
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 1.77e-6 PROSPERO
internal_repeat_1 67 288 6.51e-9 PROSPERO
internal_repeat_2 93 401 1.04e-6 PROSPERO
internal_repeat_3 380 607 1.77e-6 PROSPERO
internal_repeat_1 428 651 6.51e-9 PROSPERO
internal_repeat_2 524 836 1.04e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1107 1133 N/A INTRINSIC
coiled coil region 1159 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120853
Predicted Effect probably null
Transcript: ENSMUST00000126746
SMART Domains Protein: ENSMUSP00000122002
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 73 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131021
Predicted Effect probably null
Transcript: ENSMUST00000132893
SMART Domains Protein: ENSMUSP00000118419
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 210 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138126
Predicted Effect probably null
Transcript: ENSMUST00000140846
SMART Domains Protein: ENSMUSP00000119905
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 3 301 3.65e-15 PROSPERO
internal_repeat_2 12 320 8.53e-7 PROSPERO
internal_repeat_1 301 599 3.65e-15 PROSPERO
internal_repeat_2 443 755 8.53e-7 PROSPERO
low complexity region 760 772 N/A INTRINSIC
low complexity region 800 811 N/A INTRINSIC
coiled coil region 1026 1052 N/A INTRINSIC
coiled coil region 1078 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146888
Predicted Effect probably null
Transcript: ENSMUST00000153425
SMART Domains Protein: ENSMUSP00000121719
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 67 288 6.06e-9 PROSPERO
internal_repeat_3 69 314 2.4e-5 PROSPERO
internal_repeat_2 93 340 2.83e-6 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 397 620 6.06e-9 PROSPERO
internal_repeat_2 493 744 2.83e-6 PROSPERO
internal_repeat_3 531 799 2.4e-5 PROSPERO
low complexity region 810 822 N/A INTRINSIC
low complexity region 850 861 N/A INTRINSIC
coiled coil region 1076 1102 N/A INTRINSIC
coiled coil region 1128 1158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
D430041D05Rik GTGATGATGATGATGATGATG GTGATGATGATGATGATG 2: 104,221,208 probably benign Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Sfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Sfi1 APN 11 3134337 missense probably benign 0.05
IGL00990:Sfi1 APN 11 3135671 missense probably damaging 0.99
IGL00990:Sfi1 APN 11 3143689 splice site probably benign
IGL03147:Sfi1 UTSW 11 3186080 missense possibly damaging 0.94
R0081:Sfi1 UTSW 11 3146254 frame shift probably null
R0082:Sfi1 UTSW 11 3146254 frame shift probably null
R0118:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0197:Sfi1 UTSW 11 3146254 frame shift probably null
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0242:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0816:Sfi1 UTSW 11 3146254 frame shift probably null
R1147:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3146254 frame shift probably null
R1148:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1185:Sfi1 UTSW 11 3146254 frame shift probably null
R1185:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1207:Sfi1 UTSW 11 3146254 frame shift probably null
R1207:Sfi1 UTSW 11 3146255 frame shift probably null
R1207:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1403:Sfi1 UTSW 11 3146254 frame shift probably null
R1403:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1404:Sfi1 UTSW 11 3146254 frame shift probably null
R1404:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1405:Sfi1 UTSW 11 3146254 frame shift probably null
R1405:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1465:Sfi1 UTSW 11 3146254 frame shift probably null
R1469:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1470:Sfi1 UTSW 11 3146254 frame shift probably null
R1470:Sfi1 UTSW 11 3146255 frame shift probably null
R2871:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R5228:Sfi1 UTSW 11 3153384 intron probably benign
R5276:Sfi1 UTSW 11 3153384 intron probably benign
R5298:Sfi1 UTSW 11 3153384 intron probably benign
R5343:Sfi1 UTSW 11 3153384 intron probably benign
R5376:Sfi1 UTSW 11 3153384 intron probably benign
R5384:Sfi1 UTSW 11 3153382 intron probably benign
R5385:Sfi1 UTSW 11 3153382 intron probably benign
R5386:Sfi1 UTSW 11 3153384 intron probably benign
R5411:Sfi1 UTSW 11 3153384 intron probably benign
R5431:Sfi1 UTSW 11 3153384 intron probably benign
R5795:Sfi1 UTSW 11 3153384 intron probably benign
R5808:Sfi1 UTSW 11 3153384 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCAGGAGAAAGTACCGGCTAA -3'
(R):5'- ACCTAGCAAACTGGTGAAGATCAAACAT -3'

Sequencing Primer
(F):5'- TGAGATCAAAAGGCCCTCATTCTG -3'
(R):5'- CAAACATAACACTTCATTCTGTTCC -3'
Posted On2014-04-13