Incidental Mutation 'R1574:Fndc3a'
ID171053
Institutional Source Beutler Lab
Gene Symbol Fndc3a
Ensembl Gene ENSMUSG00000033487
Gene Namefibronectin type III domain containing 3A
Synonyms1700094E19Rik, Fndc3, D14Ertd453e, F730017H24Rik, sys
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location72537946-72710003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72556557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 892 (I892N)
Ref Sequence ENSEMBL: ENSMUSP00000086411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089017]
Predicted Effect probably damaging
Transcript: ENSMUST00000089017
AA Change: I892N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086411
Gene: ENSMUSG00000033487
AA Change: I892N

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
FN3 467 549 1.84e-9 SMART
FN3 564 647 1.06e-5 SMART
FN3 662 744 2.19e-7 SMART
FN3 759 838 5.48e-8 SMART
FN3 864 937 2.28e-5 SMART
FN3 951 1032 3.22e-5 SMART
FN3 1047 1127 5.63e0 SMART
transmembrane domain 1175 1197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159144
Predicted Effect unknown
Transcript: ENSMUST00000162825
AA Change: I847N
SMART Domains Protein: ENSMUSP00000124218
Gene: ENSMUSG00000033487
AA Change: I847N

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 158 172 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
FN3 222 314 3.05e-6 SMART
FN3 327 408 3.42e-9 SMART
FN3 423 505 1.84e-9 SMART
FN3 520 603 1.06e-5 SMART
FN3 618 700 2.19e-7 SMART
FN3 715 794 5.48e-8 SMART
FN3 820 893 2.28e-5 SMART
FN3 907 988 3.22e-5 SMART
FN3 1003 1083 5.63e0 SMART
transmembrane domain 1131 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Males homozygous for an insertional mutation are sterile; females are fertile. In mutant males, spermatids form multinucleated syncytia and fail to mature, while Sertoli cells exhibit abnormal cytoplasmic vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
D430041D05Rik GTGATGATGATGATGATGATG GTGATGATGATGATGATG 2: 104,221,208 probably benign Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Fndc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Fndc3a APN 14 72559357 splice site probably benign
IGL01120:Fndc3a APN 14 72556662 missense probably benign 0.05
IGL01577:Fndc3a APN 14 72589858 missense probably damaging 0.99
IGL01810:Fndc3a APN 14 72566141 missense probably benign 0.01
IGL01965:Fndc3a APN 14 72540402 missense probably benign 0.09
IGL01992:Fndc3a APN 14 72574556 missense probably benign 0.25
IGL02244:Fndc3a APN 14 72556367 splice site probably benign
IGL02639:Fndc3a APN 14 72574357 missense probably benign 0.08
IGL03076:Fndc3a APN 14 72556468 missense possibly damaging 0.82
IGL03096:Fndc3a APN 14 72599119 missense probably damaging 1.00
R0112:Fndc3a UTSW 14 72540495 splice site probably benign
R0379:Fndc3a UTSW 14 72556609 missense probably damaging 1.00
R0381:Fndc3a UTSW 14 72556627 missense probably benign 0.05
R0544:Fndc3a UTSW 14 72557622 splice site probably benign
R1079:Fndc3a UTSW 14 72589807 missense possibly damaging 0.81
R1299:Fndc3a UTSW 14 72566198 splice site probably benign
R1424:Fndc3a UTSW 14 72574371 missense probably damaging 1.00
R1453:Fndc3a UTSW 14 72540328 nonsense probably null
R1478:Fndc3a UTSW 14 72557632 critical splice donor site probably null
R1573:Fndc3a UTSW 14 72568944 missense probably damaging 0.98
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1743:Fndc3a UTSW 14 72652081 missense probably damaging 1.00
R1852:Fndc3a UTSW 14 72556843 missense probably damaging 0.96
R2097:Fndc3a UTSW 14 72574351 critical splice donor site probably null
R2396:Fndc3a UTSW 14 72683683 missense possibly damaging 0.92
R2512:Fndc3a UTSW 14 72556275 missense probably benign 0.00
R3722:Fndc3a UTSW 14 72540208 missense probably benign 0.39
R5470:Fndc3a UTSW 14 72574568 missense possibly damaging 0.83
R5757:Fndc3a UTSW 14 72556585 missense probably benign
R5931:Fndc3a UTSW 14 72568867 missense probably benign
R6188:Fndc3a UTSW 14 72589961 missense probably damaging 0.99
R6297:Fndc3a UTSW 14 72563540 missense probably damaging 0.98
R6638:Fndc3a UTSW 14 72559248 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTATGGCTGAAAGGCCCAGCTC -3'
(R):5'- AGTTGTTGCCTGTGTGACTCCACC -3'

Sequencing Primer
(F):5'- AGCTCCAAGGCTATTCAAGG -3'
(R):5'- TGTGTGACTCCACCGTCAG -3'
Posted On2014-04-13