Incidental Mutation 'R1574:Ankrd12'
ID171062
Institutional Source Beutler Lab
Gene Symbol Ankrd12
Ensembl Gene ENSMUSG00000034647
Gene Nameankyrin repeat domain 12
Synonyms2900001A12Rik, GAC-1, ANCO-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65967501-66077089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65986274 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 721 (D721E)
Ref Sequence ENSEMBL: ENSMUSP00000039035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038116] [ENSMUST00000150766]
Predicted Effect probably benign
Transcript: ENSMUST00000038116
AA Change: D721E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647
AA Change: D721E

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
ANK 184 213 8.78e-6 SMART
ANK 217 246 1.76e-5 SMART
ANK 250 279 7.64e-6 SMART
low complexity region 292 300 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
coiled coil region 459 497 N/A INTRINSIC
coiled coil region 639 676 N/A INTRINSIC
coiled coil region 725 752 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 999 1018 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
low complexity region 1182 1197 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146090
Predicted Effect probably benign
Transcript: ENSMUST00000150766
SMART Domains Protein: ENSMUSP00000114237
Gene: ENSMUSG00000034647

DomainStartEndE-ValueType
low complexity region 78 98 N/A INTRINSIC
ANK 161 190 8.78e-6 SMART
ANK 194 223 1.76e-5 SMART
ANK 227 256 7.64e-6 SMART
low complexity region 269 277 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
D430041D05Rik GTGATGATGATGATGATGATG GTGATGATGATGATGATG 2: 104,221,208 probably benign Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Ankrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ankrd12 APN 17 65986174 missense probably benign
IGL00555:Ankrd12 APN 17 65984976 missense probably benign 0.09
IGL00790:Ankrd12 APN 17 65984180 missense probably benign
IGL00808:Ankrd12 APN 17 65983965 missense probably benign 0.03
IGL01355:Ankrd12 APN 17 65970340 splice site probably benign
IGL01707:Ankrd12 APN 17 65984278 missense probably damaging 0.98
IGL02045:Ankrd12 APN 17 65986249 missense probably benign 0.17
IGL02125:Ankrd12 APN 17 65970144 utr 3 prime probably benign
IGL02292:Ankrd12 APN 17 66042587 missense probably damaging 0.99
IGL02376:Ankrd12 APN 17 66042529 intron probably benign
IGL02435:Ankrd12 APN 17 65987156 missense probably damaging 1.00
IGL02530:Ankrd12 APN 17 65984403 missense probably benign 0.20
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0094:Ankrd12 UTSW 17 65970176 missense probably damaging 1.00
R0195:Ankrd12 UTSW 17 66049948 splice site probably null
R0227:Ankrd12 UTSW 17 65987227 missense probably benign 0.00
R0363:Ankrd12 UTSW 17 65985681 missense probably damaging 1.00
R0366:Ankrd12 UTSW 17 65984506 missense possibly damaging 0.93
R0376:Ankrd12 UTSW 17 66053009 missense probably damaging 0.98
R0470:Ankrd12 UTSW 17 65986134 missense probably benign 0.00
R0480:Ankrd12 UTSW 17 66049828 missense possibly damaging 0.47
R0538:Ankrd12 UTSW 17 66049852 missense probably damaging 1.00
R0883:Ankrd12 UTSW 17 65985132 missense probably benign 0.19
R1181:Ankrd12 UTSW 17 66042574 missense probably benign 0.36
R1386:Ankrd12 UTSW 17 65983380 missense possibly damaging 0.94
R1476:Ankrd12 UTSW 17 65986305 missense probably damaging 0.99
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1602:Ankrd12 UTSW 17 65983688 nonsense probably null
R1728:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1729:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1784:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1795:Ankrd12 UTSW 17 65986227 missense possibly damaging 0.89
R1901:Ankrd12 UTSW 17 65986703 missense possibly damaging 0.58
R1929:Ankrd12 UTSW 17 65986686 missense possibly damaging 0.55
R1952:Ankrd12 UTSW 17 66031571 missense probably damaging 0.98
R1997:Ankrd12 UTSW 17 65984884 missense probably damaging 1.00
R2207:Ankrd12 UTSW 17 66031574 splice site probably null
R3612:Ankrd12 UTSW 17 65983547 missense probably benign 0.01
R3768:Ankrd12 UTSW 17 65985720 missense probably benign
R3909:Ankrd12 UTSW 17 65984005 missense probably benign 0.05
R3945:Ankrd12 UTSW 17 65976103 missense probably damaging 1.00
R4176:Ankrd12 UTSW 17 66027366 missense probably damaging 1.00
R4461:Ankrd12 UTSW 17 65985937 unclassified probably null
R4628:Ankrd12 UTSW 17 65985994 missense probably benign
R4726:Ankrd12 UTSW 17 65970324 missense probably damaging 1.00
R4785:Ankrd12 UTSW 17 65982999 missense probably damaging 1.00
R4828:Ankrd12 UTSW 17 65984637 missense probably damaging 0.99
R4847:Ankrd12 UTSW 17 66024092 missense probably benign 0.14
R4858:Ankrd12 UTSW 17 66031433 missense probably damaging 1.00
R5344:Ankrd12 UTSW 17 66049848 missense probably damaging 1.00
R5749:Ankrd12 UTSW 17 65986096 missense probably benign 0.02
R7132:Ankrd12 UTSW 17 65983247 missense not run
Predicted Primers PCR Primer
(F):5'- AAGCGCCGATCAGACTTTTCCC -3'
(R):5'- AACTCAGACTGCACACTGAAGAAGATG -3'

Sequencing Primer
(F):5'- TCTGATGAATGCAGCCCTG -3'
(R):5'- aaaggaagttgaaggtgaaaagg -3'
Posted On2014-04-13