Incidental Mutation 'R1575:Pax3'
ID171068
Institutional Source Beutler Lab
Gene Symbol Pax3
Ensembl Gene ENSMUSG00000004872
Gene Namepaired box 3
SynonymsPax-3
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78101267-78197134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78103484 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 422 (T422A)
Ref Sequence ENSEMBL: ENSMUSP00000004994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]
Predicted Effect probably benign
Transcript: ENSMUST00000004994
AA Change: T422A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: T422A

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 347 391 5.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087086
AA Change: T422A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: T422A

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 346 391 5.3e-27 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N59K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S959P probably damaging Het
Mast4 G A 13: 102,739,263 P1299L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E2021G probably benign Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Pax3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pax3 APN 1 78196663 unclassified probably null
IGL02249:Pax3 APN 1 78195325 missense probably damaging 0.98
IGL02271:Pax3 APN 1 78195332 missense probably damaging 1.00
IGL02376:Pax3 APN 1 78132292 missense probably damaging 1.00
IGL02530:Pax3 APN 1 78121787 missense possibly damaging 0.87
IGL02950:Pax3 APN 1 78103360 missense probably benign 0.06
Nidoqueen UTSW 1 78132232 missense probably damaging 1.00
stemware UTSW 1 78132347 missense
Widget UTSW 1 78122590 critical splice donor site probably null
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0523:Pax3 UTSW 1 78195441 missense possibly damaging 0.83
R1831:Pax3 UTSW 1 78132340 missense probably damaging 1.00
R1934:Pax3 UTSW 1 78103480 missense possibly damaging 0.90
R2420:Pax3 UTSW 1 78196864 unclassified probably null
R2473:Pax3 UTSW 1 78122590 critical splice donor site probably null
R4430:Pax3 UTSW 1 78195324 missense probably damaging 1.00
R4693:Pax3 UTSW 1 78196746 missense probably benign 0.00
R4818:Pax3 UTSW 1 78132232 missense probably damaging 1.00
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R5302:Pax3 UTSW 1 78121612 missense possibly damaging 0.88
R5475:Pax3 UTSW 1 78103418 missense probably benign 0.06
R5855:Pax3 UTSW 1 78121651 missense probably damaging 0.99
R6102:Pax3 UTSW 1 78132347 missense probably damaging 1.00
R6190:Pax3 UTSW 1 78192549 missense possibly damaging 0.63
R6856:Pax3 UTSW 1 78132419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTTCCCCGTTCTCAAGCAAG -3'
(R):5'- TCAGAAAAGCTCCTCAATGGCTGTC -3'

Sequencing Primer
(F):5'- AGCAAGAGGTGATCTCTCTCC -3'
(R):5'- GCTCCTCAATGGCTGTCTAGAG -3'
Posted OnApr 13, 2014