Incidental Mutation 'R1575:Palb2'
ID171099
Institutional Source Beutler Lab
Gene Symbol Palb2
Ensembl Gene ENSMUSG00000044702
Gene Namepartner and localizer of BRCA2
Synonyms
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122107262-122132985 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 122110838 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000131657] [ENSMUST00000142952]
Predicted Effect probably null
Transcript: ENSMUST00000063587
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098068
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106468
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect probably null
Transcript: ENSMUST00000106469
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131657
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154508
Meta Mutation Damage Score 0.6236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality with impaired inner cell mass proliferation, impaired gastrulation, absence of the amnion, somites and tail bud, and general improper organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Palb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Palb2 APN 7 122121048 splice site probably benign
IGL00232:Palb2 APN 7 122121064 missense probably damaging 0.99
IGL02171:Palb2 APN 7 122107586 missense probably damaging 1.00
IGL03030:Palb2 APN 7 122113256 missense probably damaging 1.00
IGL03102:Palb2 APN 7 122124499 missense possibly damaging 0.88
R0128:Palb2 UTSW 7 122128166 nonsense probably null
R1192:Palb2 UTSW 7 122128209 missense probably benign 0.11
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1664:Palb2 UTSW 7 122124392 utr 3 prime probably benign
R1852:Palb2 UTSW 7 122114314 missense possibly damaging 0.93
R1984:Palb2 UTSW 7 122127080 missense probably damaging 0.96
R2061:Palb2 UTSW 7 122124525 missense possibly damaging 0.86
R2121:Palb2 UTSW 7 122127781 missense possibly damaging 0.61
R2877:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R2878:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R3923:Palb2 UTSW 7 122117360 splice site probably null
R4609:Palb2 UTSW 7 122124723 missense probably benign 0.16
R4629:Palb2 UTSW 7 122127966 missense possibly damaging 0.89
R4678:Palb2 UTSW 7 122127366 missense probably damaging 0.99
R5111:Palb2 UTSW 7 122117305 nonsense probably null
R5381:Palb2 UTSW 7 122128413 missense probably benign 0.06
R5470:Palb2 UTSW 7 122114351 missense probably damaging 1.00
R5793:Palb2 UTSW 7 122127637 missense probably benign 0.05
R6160:Palb2 UTSW 7 122128420 unclassified probably null
R6630:Palb2 UTSW 7 122124529 missense probably damaging 0.97
R6783:Palb2 UTSW 7 122127488 missense probably damaging 1.00
R6897:Palb2 UTSW 7 122127047 critical splice donor site probably null
R7040:Palb2 UTSW 7 122114399 missense possibly damaging 0.88
R7121:Palb2 UTSW 7 122124834 missense not run
X0060:Palb2 UTSW 7 122114478 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCTCTACCAGTGAGCAACCTCTG -3'
(R):5'- TTTCCCAGTGGATGGCACAAGG -3'

Sequencing Primer
(F):5'- CCTCTGTAACACAATAGCCTTTAG -3'
(R):5'- GAACCTGAGGAGTCTGCTG -3'
Posted On2014-04-13