Incidental Mutation 'R1575:Robo3'
ID171106
Institutional Source Beutler Lab
Gene Symbol Robo3
Ensembl Gene ENSMUSG00000032128
Gene Nameroundabout guidance receptor 3
SynonymsRig1, Rig-1, Robo3b, Robo3a, Rbig1
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1575 (G1)
Quality Score105
Status Validated
Chromosome9
Chromosomal Location37415669-37433246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37429661 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 83 (A83E)
Ref Sequence ENSEMBL: ENSMUSP00000034643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512]
Predicted Effect probably damaging
Transcript: ENSMUST00000034643
AA Change: A83E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: A83E

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115038
AA Change: A105E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: A105E

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170512
AA Change: A83E

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Robo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Robo3 APN 9 37427754 critical splice donor site probably null
IGL01023:Robo3 APN 9 37429551 missense probably damaging 1.00
IGL01431:Robo3 APN 9 37419111 unclassified probably benign
IGL01993:Robo3 APN 9 37424653 missense probably damaging 1.00
IGL02256:Robo3 APN 9 37425353 missense probably damaging 1.00
IGL02323:Robo3 APN 9 37422201 missense probably benign 0.05
IGL02561:Robo3 APN 9 37427091 missense possibly damaging 0.84
IGL02866:Robo3 APN 9 37422306 missense possibly damaging 0.89
IGL02897:Robo3 APN 9 37427502 nonsense probably null
IGL03003:Robo3 APN 9 37419291 missense probably damaging 1.00
IGL03307:Robo3 APN 9 37422564 missense probably damaging 0.96
IGL03097:Robo3 UTSW 9 37422528 critical splice donor site probably null
R0137:Robo3 UTSW 9 37425344 missense probably benign 0.00
R0266:Robo3 UTSW 9 37422640 missense probably damaging 0.96
R0390:Robo3 UTSW 9 37422177 missense probably benign 0.00
R0505:Robo3 UTSW 9 37416759 unclassified probably benign
R0815:Robo3 UTSW 9 37422183 missense probably damaging 1.00
R0924:Robo3 UTSW 9 37429482 splice site probably benign
R1167:Robo3 UTSW 9 37423907 nonsense probably null
R1203:Robo3 UTSW 9 37418682 missense probably damaging 1.00
R1451:Robo3 UTSW 9 37417711 missense probably benign 0.01
R1596:Robo3 UTSW 9 37424632 critical splice donor site probably null
R1660:Robo3 UTSW 9 37429144 missense probably damaging 1.00
R1677:Robo3 UTSW 9 37417709 missense possibly damaging 0.75
R1839:Robo3 UTSW 9 37422327 missense probably benign 0.00
R1878:Robo3 UTSW 9 37422165 missense probably damaging 1.00
R1891:Robo3 UTSW 9 37428055 missense probably damaging 1.00
R2040:Robo3 UTSW 9 37427464 missense probably damaging 1.00
R2859:Robo3 UTSW 9 37428104 nonsense probably null
R3786:Robo3 UTSW 9 37422225 missense probably damaging 1.00
R3886:Robo3 UTSW 9 37422181 nonsense probably null
R3888:Robo3 UTSW 9 37422181 nonsense probably null
R3910:Robo3 UTSW 9 37419295 missense probably damaging 1.00
R4212:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4213:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4691:Robo3 UTSW 9 37425218 missense probably damaging 0.99
R4979:Robo3 UTSW 9 37423344 missense probably damaging 1.00
R5238:Robo3 UTSW 9 37416879 missense probably damaging 0.99
R5570:Robo3 UTSW 9 37425275 missense possibly damaging 0.81
R5629:Robo3 UTSW 9 37419211 nonsense probably null
R5770:Robo3 UTSW 9 37419201 missense possibly damaging 0.87
R5837:Robo3 UTSW 9 37429816 critical splice acceptor site probably null
R6021:Robo3 UTSW 9 37422533 nonsense probably null
R6129:Robo3 UTSW 9 37423293 missense probably benign
R6232:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6233:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6235:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6326:Robo3 UTSW 9 37427027 missense probably damaging 1.00
R6354:Robo3 UTSW 9 37417217 unclassified probably benign
R6355:Robo3 UTSW 9 37418939 missense possibly damaging 0.71
R6475:Robo3 UTSW 9 37423290 missense probably damaging 0.99
R6937:Robo3 UTSW 9 37429880 missense probably benign 0.16
R7201:Robo3 UTSW 9 37424330 nonsense probably null
R7208:Robo3 UTSW 9 37424724 missense probably damaging 0.99
R7249:Robo3 UTSW 9 37424833 missense probably benign
X0024:Robo3 UTSW 9 37427855 missense probably damaging 1.00
X0027:Robo3 UTSW 9 37427825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACGAACTCTCTTACCAGCTAC -3'
(R):5'- CTTCAGAGCAAACCTGGTCTTCCC -3'

Sequencing Primer
(F):5'- TCTTACCAGCTACTTCCAGAGAG -3'
(R):5'- GGGTACTTGGAGTTACCTTCTTCTC -3'
Posted On2014-04-13