Incidental Mutation 'R1575:Alox8'
ID171116
Institutional Source Beutler Lab
Gene Symbol Alox8
Ensembl Gene ENSMUSG00000020891
Gene Namearachidonate 8-lipoxygenase
Synonyms8-LOX, 8S-lipoxygenase, 8S-LOX, Alox15b
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R1575 (G1)
Quality Score108
Status Validated
Chromosome11
Chromosomal Location69183932-69197843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69185241 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 628 (H628L)
Ref Sequence ENSEMBL: ENSMUSP00000021262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021262] [ENSMUST00000094078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021262
AA Change: H628L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021262
Gene: ENSMUSG00000020891
AA Change: H628L

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 163 662 5.5e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094078
AA Change: H599L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091621
Gene: ENSMUSG00000020891
AA Change: H599L

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 205 405 6.9e-44 PFAM
Pfam:Lipoxygenase 402 640 1.9e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144787
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene belongs to the lipoxygenase (LOX) gene family whose members encode enzymes that catalyze the addition of molecular oxygen to polyunsaturated fatty acids (PUFAs) to yield fatty acid hydroperoxides. The encoded enzyme preferentially metabolizes arachidonic acid to yield 8-hydroxyeicosatetraenoic acid (8-HETE), while metabolizing linoleic acid less efficiently. The gene may also function as a tumor suppressor. This gene is located in a cluster of related genes that spans approximately 75 kilobases on chromosome 11. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Alox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Alox8 APN 11 69188690 missense probably benign
IGL01878:Alox8 APN 11 69197038 missense probably benign 0.00
IGL02342:Alox8 APN 11 69186227 missense probably damaging 1.00
IGL02694:Alox8 APN 11 69186629 missense probably damaging 0.99
IGL03246:Alox8 APN 11 69186015 missense probably damaging 1.00
IGL03373:Alox8 APN 11 69186617 missense probably benign 0.00
R0567:Alox8 UTSW 11 69191522 critical splice donor site probably null
R1688:Alox8 UTSW 11 69189906 missense probably benign 0.01
R2021:Alox8 UTSW 11 69186288 missense probably damaging 0.98
R2041:Alox8 UTSW 11 69197691 missense possibly damaging 0.67
R2175:Alox8 UTSW 11 69187766 missense possibly damaging 0.85
R2237:Alox8 UTSW 11 69185771 missense probably benign 0.00
R3821:Alox8 UTSW 11 69186482 missense probably damaging 0.98
R4870:Alox8 UTSW 11 69186568 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69186505 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69189889 missense possibly damaging 0.82
R7003:Alox8 UTSW 11 69191590 missense possibly damaging 0.70
R7158:Alox8 UTSW 11 69185870 missense probably benign 0.00
R7316:Alox8 UTSW 11 69186238 missense probably benign 0.01
X0065:Alox8 UTSW 11 69185253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGAAGCTCAGGGTCTCCAAAC -3'
(R):5'- GCTCAACCAAGGACTGTGTAAGGTG -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtAAGATGGGG -3'
(R):5'- ACTGTGTAAGGTGACCGGG -3'
Posted On2014-04-13