Incidental Mutation 'R1575:Naip2'
ID171121
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene NameNLR family, apoptosis inhibitory protein 2
SynonymsBirc1b, Naip2, Naip-rs6
MMRRC Submission 039613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1575 (G1)
Quality Score93
Status Validated
Chromosome13
Chromosomal Location100144063-100202092 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 100155029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
Predicted Effect probably benign
Transcript: ENSMUST00000067975
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117913
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167986
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221573
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Atp13a4 T C 16: 29,409,710 D984G probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGAACTGGAGATCAAGCACCATC -3'
(R):5'- TGTGAGTCTAGAGTCCAGCACAGG -3'

Sequencing Primer
(F):5'- CATCCCTTACCTAGTTTGGAGAG -3'
(R):5'- ACAGGGCTTGCCCTAGAG -3'
Posted On2014-04-13