Incidental Mutation 'R1575:Atp13a4'
ID171130
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene NameATPase type 13A4
Synonyms9330174J19Rik, 4631413J11Rik
MMRRC Submission 039613-MU
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1575 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29395853-29544864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29409710 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 984 (D984G)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
Predicted Effect probably benign
Transcript: ENSMUST00000057018
AA Change: D984G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: D984G

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182357
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect probably benign
Transcript: ENSMUST00000182627
AA Change: D1003G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: D1003G

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182676
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T A 3: 148,852,762 T437S probably benign Het
Akna A G 4: 63,379,333 F828S probably benign Het
Alg9 G T 9: 50,775,502 A40S possibly damaging Het
Alox8 T A 11: 69,185,241 H628L possibly damaging Het
Aox3 T C 1: 58,152,554 W422R probably benign Het
Bcam T C 7: 19,760,382 E363G possibly damaging Het
Cadps2 C A 6: 23,429,218 V519F probably damaging Het
Calca A G 7: 114,635,161 Y18H probably damaging Het
Cd70 A G 17: 57,146,364 I100T probably damaging Het
Cdk4 T A 10: 127,064,651 H95Q probably damaging Het
Chchd1 T A 14: 20,703,342 N11K probably damaging Het
Cma2 T A 14: 55,972,815 N52K probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dicer1 A G 12: 104,721,969 probably null Het
Dnajc13 A G 9: 104,156,838 S2206P probably benign Het
Dtl T C 1: 191,561,546 probably null Het
Fam186b T C 15: 99,286,971 T24A probably benign Het
Fbxw21 A G 9: 109,161,916 V25A probably benign Het
Gins1 T C 2: 150,912,838 S45P probably benign Het
Gtpbp2 T A 17: 46,165,943 V349D probably damaging Het
Hyal5 G T 6: 24,876,793 D222Y probably damaging Het
Itgal A G 7: 127,300,888 probably null Het
Klk14 A G 7: 43,693,953 probably null Het
Lama1 T A 17: 67,810,409 L2518Q possibly damaging Het
Lrrc2 G A 9: 110,979,487 G264D probably benign Het
Ltbp4 A G 7: 27,322,820 S893P probably damaging Het
Mast4 G A 13: 102,739,263 P1107L probably damaging Het
Mbd1 T A 18: 74,275,419 probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Ncan G A 8: 70,110,198 T470I probably benign Het
Npy1r A T 8: 66,704,161 I78F probably damaging Het
Olfr1491 A T 19: 13,705,525 M233L probably benign Het
Olfr917 G A 9: 38,665,277 T189M probably damaging Het
Palb2 A T 7: 122,110,838 probably null Het
Pax3 T C 1: 78,103,484 T422A probably benign Het
Pebp1 A T 5: 117,286,164 D72E possibly damaging Het
Pnliprp1 A T 19: 58,740,469 T363S probably benign Het
Rbm44 G A 1: 91,156,843 probably null Het
Rbm47 T A 5: 66,025,015 Y425F probably benign Het
Robo3 G T 9: 37,429,661 A83E probably damaging Het
Rrm1 A G 7: 102,456,514 Y279C probably damaging Het
Rslcan18 A T 13: 67,108,057 probably benign Het
Scara5 C A 14: 65,730,865 Q196K probably benign Het
Setd1b C T 5: 123,163,147 probably benign Het
Siah1a A G 8: 86,725,241 F205S probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Ssu72 A G 4: 155,731,357 D86G probably benign Het
St7 G T 6: 17,886,111 K357N probably damaging Het
Sv2b G A 7: 75,147,677 T323I probably damaging Het
Syt1 T C 10: 108,504,500 N319S probably benign Het
Tanc1 T A 2: 59,791,651 F371L probably damaging Het
Tcf20 C A 15: 82,855,492 G586V probably benign Het
Tg T C 15: 66,729,685 probably null Het
Tyk2 A T 9: 21,115,462 N620K probably benign Het
Ube2j1 T A 4: 33,045,116 S130T probably benign Het
Ubr2 G T 17: 46,932,492 P1696H probably damaging Het
Ubr5 A T 15: 38,040,841 D266E probably damaging Het
Vipr2 A G 12: 116,144,272 T426A probably benign Het
Vmn2r104 A T 17: 20,042,215 W218R probably damaging Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vwf A G 6: 125,655,251 E82G unknown Het
Vwf T A 6: 125,663,571 Y2323* probably null Het
Wdr76 T G 2: 121,528,921 V329G probably damaging Het
Zan A G 5: 137,461,952 C1226R unknown Het
Zbtb16 G T 9: 48,832,272 Q247K probably damaging Het
Zfp541 T C 7: 16,078,715 V431A possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACCGTGGCAAGCACTGTTAAGAG -3'
(R):5'- CAACCCCAAGCTCGTGCCTTTCAG -3'

Sequencing Primer
(F):5'- CCGGGAAAGTTAGAACCCCTTATTAG -3'
(R):5'- TGCCTTTCAGACCCGCAG -3'
Posted On2014-04-13