Incidental Mutation 'R1576:Rfxank'
ID171168
Institutional Source Beutler Lab
Gene Symbol Rfxank
Ensembl Gene ENSMUSG00000036120
Gene Nameregulatory factor X-associated ankyrin-containing protein
SynonymsTvl1
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70130794-70139154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70134303 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 221 (R221L)
Ref Sequence ENSEMBL: ENSMUSP00000148739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075724] [ENSMUST00000095273] [ENSMUST00000211898] [ENSMUST00000212320]
Predicted Effect probably benign
Transcript: ENSMUST00000075724
AA Change: R211L

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075140
Gene: ENSMUSG00000036120
AA Change: R211L

DomainStartEndE-ValueType
ANK 132 161 1.36e-2 SMART
ANK 165 194 5.16e-3 SMART
ANK 198 227 7.42e-4 SMART
ANK 231 260 2.35e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095273
SMART Domains Protein: ENSMUSP00000092907
Gene: ENSMUSG00000071078

DomainStartEndE-ValueType
SCOP:d1jhja_ 22 64 6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211970
Predicted Effect possibly damaging
Transcript: ENSMUST00000212320
AA Change: R221L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212851
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Rfxank
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4303:Rfxank UTSW 8 70136212 missense probably damaging 1.00
R7033:Rfxank UTSW 8 70138170 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTCCTACCAGGATCTAGCACCC -3'
(R):5'- TCACAGGCTCCAAGTGTAGACCAG -3'

Sequencing Primer
(F):5'- AAGCCCACCTTTGCGGTAT -3'
(R):5'- ATCCTGTCAGCCATGATGAG -3'
Posted On2014-04-13