Incidental Mutation 'R1579:Fastkd2'
ID171254
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene NameFAST kinase domains 2
Synonyms2810421I24Rik
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63730614-63754655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 63745887 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 477 (H477Q)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
Predicted Effect probably null
Transcript: ENSMUST00000027103
AA Change: H477Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: H477Q

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CACAACAGTAGCTGTGACTGGTAGG -3'
(R):5'- GAACCCACTCAAGTGACAAGGTGAC -3'

Sequencing Primer
(F):5'- ctaaaaccatctctatttcctgcc -3'
(R):5'- TCAAGTGACAAGGTGACTACCTAC -3'
Genotyping

NOTE: These primers have not been validated.

 

R1579:Fastkd2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R15790001_Fastkd2_PCR_F: 5’- CACAACAGTAGCTGTGACTGGTAGG-3’

R15790001_Fastkd2_PCR_R: 5’- GAACCCACTCAAGTGACAAGGTGAC-3’

 

Sequencing Primers

R15790001_Fastkd2_SEQ_F: 5’- ctaaaaccatctctatttcctgcc-3’
 

R15790001_Fastkd2_SEQ_R: 5’- TCAAGTGACAAGGTGACTACCTAC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 741 nucleotides is amplified (Chr.16: 36772211-36772629, GRCm38; NCBI RefSeq: NC_000067):

 

cacaacagta gctgtgactg gtagggttag gctcgtaagt cattaccaag aattttgata       

gctaggaatg tttaattgct tataaaactg cagtgccagt ctaggccttg tagaaactgt       

gacgagtaaa aggctctggt gcctgaccac ttaggttcta aaaccatctc tatttcctgc      

ccatccactg taattagttc atggatgagt tattcaactt ctgagcctgt tcactcatct      

ttatttatga gaataataat actgctaccc catagagttt taataggagt gaaatgactg      

aaagccagcc tataaaacat ttttatgcag tatatctgca ggagtcattt attggatatg      

tacacttact atgggggtct agccacatct tgcactaggt atgggtactt atttgcaaat      

ctgattgttt catctcattt ctttgaattc cttgaagatc ttgggtctgt agcatggagt      

cagctcttct gtgaccttgt cttataggtt gatttgaaat ctgactttcc tttgttcccc      

acaaggttcc tagaagctct ggcgagtgct ctgactggct gtcttcacca catttcttct      

gaaagcctgt tgaatgctgt gcattcgttt tgcatgatga attatttccc tctggcccct      

attaaccagc ttatcaaaga gaatatcatc aacgaactgc tgacttcggg taggtagtca      

ccttgtcact tgagtgggtt c

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C is shown in red text (Chr. + strand, C>G).

Posted On2014-04-13