Incidental Mutation 'R1579:Zfp408'
ID171263
Institutional Source Beutler Lab
Gene Symbol Zfp408
Ensembl Gene ENSMUSG00000075040
Gene Namezinc finger protein 408
SynonymsLOC381410
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91643669-91649791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91646128 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 227 (L227P)
Ref Sequence ENSEMBL: ENSMUSP00000106965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090614] [ENSMUST00000099714] [ENSMUST00000111329] [ENSMUST00000111331] [ENSMUST00000111333] [ENSMUST00000145582]
Predicted Effect probably benign
Transcript: ENSMUST00000090614
SMART Domains Protein: ENSMUSP00000088105
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099714
AA Change: L327P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097301
Gene: ENSMUSG00000075040
AA Change: L327P

DomainStartEndE-ValueType
ZnF_C2H2 344 366 7.05e-1 SMART
ZnF_C2H2 372 394 1.67e-2 SMART
ZnF_C2H2 400 422 2.24e-3 SMART
ZnF_C2H2 428 450 8.6e-5 SMART
ZnF_C2H2 459 481 5.9e-3 SMART
ZnF_C2H2 487 509 4.87e-4 SMART
ZnF_C2H2 515 537 2.95e-3 SMART
ZnF_C2H2 542 564 2.2e-2 SMART
ZnF_C2H2 570 592 1.69e-3 SMART
ZnF_C2H2 598 620 3.89e-3 SMART
low complexity region 625 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111329
SMART Domains Protein: ENSMUSP00000106961
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111331
SMART Domains Protein: ENSMUSP00000106963
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 44 58 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
SEC14 104 255 5.08e-25 SMART
low complexity region 264 278 N/A INTRINSIC
RhoGAP 297 468 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111333
AA Change: L227P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106965
Gene: ENSMUSG00000075040
AA Change: L227P

DomainStartEndE-ValueType
ZnF_C2H2 244 266 7.05e-1 SMART
ZnF_C2H2 272 294 1.67e-2 SMART
ZnF_C2H2 300 322 2.24e-3 SMART
ZnF_C2H2 328 350 8.6e-5 SMART
ZnF_C2H2 359 381 5.9e-3 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 442 464 2.2e-2 SMART
ZnF_C2H2 470 492 1.69e-3 SMART
ZnF_C2H2 498 520 3.89e-3 SMART
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127702
Predicted Effect probably benign
Transcript: ENSMUST00000145582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155045
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten tandem zinc fingers and an N-terminal SET domain, so it is likely a DNA binding protein that interacts with other proteins. In adults, the encoded protein is expressed most highly in retina. Consequently, defects in this gene have been associated with familial exudative vitreoretinopathy (FEVR) and retinitis pigmentosa (RP). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Zfp408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp408 APN 2 91648006 splice site probably benign
IGL02374:Zfp408 APN 2 91645811 missense probably damaging 1.00
IGL03012:Zfp408 APN 2 91647808 missense probably benign
R0467:Zfp408 UTSW 2 91645537 missense possibly damaging 0.86
R0981:Zfp408 UTSW 2 91645183 missense probably benign 0.38
R1673:Zfp408 UTSW 2 91646008 missense probably damaging 0.97
R1935:Zfp408 UTSW 2 91649748 start codon destroyed probably null 0.95
R2071:Zfp408 UTSW 2 91646018 missense probably damaging 0.96
R2127:Zfp408 UTSW 2 91645174 missense probably damaging 0.98
R2141:Zfp408 UTSW 2 91647849 splice site probably benign
R3688:Zfp408 UTSW 2 91646432 missense probably benign 0.00
R4681:Zfp408 UTSW 2 91645786 missense probably damaging 1.00
R4782:Zfp408 UTSW 2 91645024 missense possibly damaging 0.88
R4939:Zfp408 UTSW 2 91645105 missense probably damaging 1.00
R5306:Zfp408 UTSW 2 91646345 missense probably benign 0.06
R5344:Zfp408 UTSW 2 91645243 missense probably benign 0.15
R6054:Zfp408 UTSW 2 91649291 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTTTGCCGCATTGCTCACAC -3'
(R):5'- GTTGCTTCACGATGACAGCATGG -3'

Sequencing Primer
(F):5'- AGTGGACCACCTGATGTTCC -3'
(R):5'- GCATGGATAAACAGTGCCTAC -3'
Posted On2014-04-13