Incidental Mutation 'R1579:Uqcc1'
ID171268
Institutional Source Beutler Lab
Gene Symbol Uqcc1
Ensembl Gene ENSMUSG00000005882
Gene Nameubiquinol-cytochrome c reductase complex assembly factor 1
SynonymsBfzp, 3110038N19Rik, 2410003P15Rik, 2310079L17Rik, Cbp3, mbFZb, Uqcc
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155846894-155930310 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 155921721 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 5 (Q5*)
Ref Sequence ENSEMBL: ENSMUSP00000122886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006036] [ENSMUST00000109631] [ENSMUST00000109632] [ENSMUST00000109636] [ENSMUST00000133726] [ENSMUST00000136933] [ENSMUST00000142655] [ENSMUST00000151078] [ENSMUST00000152766] [ENSMUST00000159238]
Predicted Effect probably null
Transcript: ENSMUST00000006036
AA Change: Q11*
SMART Domains Protein: ENSMUSP00000006036
Gene: ENSMUSG00000005882
AA Change: Q11*

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 105 191 8.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109631
AA Change: Q11*
SMART Domains Protein: ENSMUSP00000105259
Gene: ENSMUSG00000005882
AA Change: Q11*

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 63 203 2.1e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109632
AA Change: Q11*
SMART Domains Protein: ENSMUSP00000105260
Gene: ENSMUSG00000005882
AA Change: Q11*

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 191 4.3e-19 PFAM
Pfam:Ubiq_cyt_C_chap 188 245 2.9e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109636
AA Change: Q11*
SMART Domains Protein: ENSMUSP00000105264
Gene: ENSMUSG00000005882
AA Change: Q11*

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 271 6.7e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123790
Predicted Effect probably null
Transcript: ENSMUST00000133726
AA Change: Q11*
Predicted Effect probably null
Transcript: ENSMUST00000136933
AA Change: Q11*
Predicted Effect probably null
Transcript: ENSMUST00000139232
AA Change: Q9*
SMART Domains Protein: ENSMUSP00000123019
Gene: ENSMUSG00000005882
AA Change: Q9*

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141501
Predicted Effect probably benign
Transcript: ENSMUST00000142655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146995
Predicted Effect probably null
Transcript: ENSMUST00000151078
AA Change: Q11*
Predicted Effect probably null
Transcript: ENSMUST00000152766
AA Change: Q5*
SMART Domains Protein: ENSMUSP00000122886
Gene: ENSMUSG00000005882
AA Change: Q5*

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 3.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155680
Predicted Effect probably benign
Transcript: ENSMUST00000159238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162749
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Uqcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Uqcc1 APN 2 155858138 missense probably damaging 1.00
IGL02883:Uqcc1 APN 2 155911829 missense possibly damaging 0.93
R0433:Uqcc1 UTSW 2 155910368 missense probably damaging 1.00
R1506:Uqcc1 UTSW 2 155911818 missense probably damaging 0.98
R4801:Uqcc1 UTSW 2 155858106 splice site probably benign
R5049:Uqcc1 UTSW 2 155910421 missense probably damaging 1.00
R6042:Uqcc1 UTSW 2 155921644 missense possibly damaging 0.48
R6526:Uqcc1 UTSW 2 155851423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTAGAAGCAACACCCTGGACAC -3'
(R):5'- AGGAACTCTTGCTAGGAGCCAGAC -3'

Sequencing Primer
(F):5'- gttcacaactgcctgtaactc -3'
(R):5'- gccagacttgaaggctaaatatg -3'
Posted On2014-04-13