Incidental Mutation 'R1579:Myo1h'
ID171277
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Namemyosin 1H
Synonyms4631401O15Rik
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114289166-114365357 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 114347435 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 545 (C545*)
Ref Sequence ENSEMBL: ENSMUSP00000144110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124316] [ENSMUST00000169347] [ENSMUST00000202006]
Predicted Effect probably null
Transcript: ENSMUST00000124316
AA Change: C545*
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952
AA Change: C545*

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169347
AA Change: C561*
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: C561*

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202006
AA Change: C545*
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: C545*

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114315071 splice site probably benign
IGL00922:Myo1h APN 5 114360485 missense probably damaging 1.00
IGL01022:Myo1h APN 5 114336300 missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114348439 missense probably damaging 1.00
IGL01469:Myo1h APN 5 114361269 missense probably damaging 1.00
IGL01626:Myo1h APN 5 114314966 missense probably damaging 1.00
IGL02026:Myo1h APN 5 114323444 missense probably null 0.07
IGL02156:Myo1h APN 5 114353911 splice site probably benign
IGL02164:Myo1h APN 5 114334096 missense probably damaging 1.00
IGL02429:Myo1h APN 5 114359738 splice site probably benign
IGL02562:Myo1h APN 5 114357992 missense probably benign 0.06
IGL02938:Myo1h APN 5 114358939 missense probably damaging 1.00
R0056:Myo1h UTSW 5 114330212 missense probably damaging 1.00
R0172:Myo1h UTSW 5 114329164 splice site probably null
R0346:Myo1h UTSW 5 114355209 missense probably benign 0.19
R0464:Myo1h UTSW 5 114360510 missense probably damaging 1.00
R0556:Myo1h UTSW 5 114319791 missense probably damaging 1.00
R0723:Myo1h UTSW 5 114319680 missense probably benign 0.20
R0751:Myo1h UTSW 5 114320686 missense probably damaging 1.00
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1646:Myo1h UTSW 5 114317632 missense possibly damaging 0.90
R1648:Myo1h UTSW 5 114336275 missense probably damaging 1.00
R1981:Myo1h UTSW 5 114353837 missense probably damaging 1.00
R2006:Myo1h UTSW 5 114361079 missense probably damaging 1.00
R2697:Myo1h UTSW 5 114355213 missense probably damaging 1.00
R3124:Myo1h UTSW 5 114328799 missense probably benign 0.04
R3195:Myo1h UTSW 5 114328740 missense probably benign
R4255:Myo1h UTSW 5 114330137 missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114348379 missense possibly damaging 0.73
R4613:Myo1h UTSW 5 114351676 missense probably benign 0.02
R4758:Myo1h UTSW 5 114349582 missense probably damaging 1.00
R4784:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114345897 nonsense probably null
R5663:Myo1h UTSW 5 114334094 missense probably damaging 1.00
R6186:Myo1h UTSW 5 114319803 missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114362147 missense probably damaging 1.00
R6344:Myo1h UTSW 5 114328715 missense probably damaging 1.00
R6345:Myo1h UTSW 5 114351708 missense probably damaging 1.00
R6383:Myo1h UTSW 5 114336264 missense probably damaging 1.00
R6444:Myo1h UTSW 5 114314956 missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114320653 missense probably damaging 1.00
R6891:Myo1h UTSW 5 114349612 missense probably damaging 1.00
R6990:Myo1h UTSW 5 114330160 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCGCTCGGCAAGTACACAAGG -3'
(R):5'- ATTATGGAGCAAGGCCACCACTG -3'

Sequencing Primer
(F):5'- TGGAACCCAGGGTCTCACTAC -3'
(R):5'- CGGTTGCCTACCAAGGAATG -3'
Posted On2014-04-13