Incidental Mutation 'R1579:Zfp316'
ID171279
Institutional Source Beutler Lab
Gene Symbol Zfp316
Ensembl Gene ENSMUSG00000046658
Gene Namezinc finger protein 316
SynonymsEmzf1
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1579 (G1)
Quality Score115
Status Not validated
Chromosome5
Chromosomal Location143249697-143270022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143253562 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 901 (E901K)
Ref Sequence ENSEMBL: ENSMUSP00000125416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000051665] [ENSMUST00000161448]
Predicted Effect probably benign
Transcript: ENSMUST00000032591
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000051665
AA Change: E901K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059418
Gene: ENSMUSG00000046658
AA Change: E901K

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161448
AA Change: E901K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658
AA Change: E901K

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197349
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Zfp316
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Zfp316 APN 5 143254426 missense probably benign 0.00
IGL01783:Zfp316 APN 5 143262876 missense unknown
R0415:Zfp316 UTSW 5 143264491 missense unknown
R0423:Zfp316 UTSW 5 143253238 missense probably damaging 0.98
R1576:Zfp316 UTSW 5 143264094 missense unknown
R1836:Zfp316 UTSW 5 143253423 missense probably damaging 1.00
R2058:Zfp316 UTSW 5 143263406 missense unknown
R4004:Zfp316 UTSW 5 143255119 missense possibly damaging 0.86
R4198:Zfp316 UTSW 5 143254471 missense probably benign 0.05
R4436:Zfp316 UTSW 5 143254048 missense probably damaging 1.00
R4961:Zfp316 UTSW 5 143253414 missense probably damaging 0.98
R5579:Zfp316 UTSW 5 143264491 missense unknown
R5642:Zfp316 UTSW 5 143264091 missense unknown
R5701:Zfp316 UTSW 5 143254377 missense probably benign 0.08
R5795:Zfp316 UTSW 5 143262839 missense unknown
R5861:Zfp316 UTSW 5 143263340 missense unknown
R5965:Zfp316 UTSW 5 143264672 unclassified probably null
R6414:Zfp316 UTSW 5 143254884 missense possibly damaging 0.71
R6547:Zfp316 UTSW 5 143254197 missense probably damaging 1.00
R6922:Zfp316 UTSW 5 143253525 missense probably damaging 0.98
X0022:Zfp316 UTSW 5 143255056 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGAATCCTCAGCCCGCCAAA -3'
(R):5'- ACCGGCGAGAAACCGTTCGTGT -3'

Sequencing Primer
(F):5'- GCTTCGATAGACCTCACAGGATG -3'
(R):5'- AGCTCGGACTTCAAGCGAC -3'
Posted On2014-04-13